Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

744,367 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Authority

Sort Ascending

Sort Descending

 Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pLKO.1 Rheb1 shRNA #2
 
Resource Report
Resource Website 		RRID:Addgene_26626 Rheb1 shRNA Homo sapiens Ampicillin PMID:18497260 shRNA directed against Rheb1. Target sequence: 5'-TTATGTTGGTTGGGAATAAGA-3'. Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:08:14 0
pEiLOV-N1
 
Resource Report
Resource Website 		RRID:Addgene_26588 iLOV mammalian codon optimized Kanamycin PMID:19060199 iLOV codon usage was optimized for mammalian cell expression by de novo gene synthesis (GenScript) and cloned into pEGFP-N1 (Clontech) via SalI and NotI to replace the GFP encoding sequence. Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Addgene 2026-10-31 02:08:14 0
pGEX iLOV
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26587 iLOV Arabidopsis thaliana Ampicillin PMID:19060199 Backbone Marker:GE Healthcare; Backbone Size:4900; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:08:14 7
pLenti CMVtight eGFP Blast (w782-1)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26584 Enhanced Green Fluorescent Protein Ampicillin Need to be transduced in a Tet-On Advanced cell line for expression of the GFP. There are a few mismatches between Addgene's sequence and Dr Campeau's sequence. The sequence difference does not affect plasmid function. Backbone Size:7580; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Tet-On Advanced vector; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:08:14 1
pLenti CMVtight eGFP Neo (w784-1)
 
Resource Report
Resource Website 		RRID:Addgene_26586 Enhanced Green Fluorescent Protein Ampicillin Need to be transduced in a Tet-On Advanced cell line for expression of GFP. There are a few mismatches between Addgene's sequence and Dr Campeau's sequence. The sequence differences do not affect GFP expression or general plasmid function. Backbone Size:8045; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Tet-On Advanced vector; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:08:14 0
pLenti CMVtight eGFP Hygro (w783-1)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26585 Enhanced Green Fluorescent Protein Ampicillin Need to be transduced in a Tet-On Advanced cell line for expression of GFP. There are a few mismatches between Addgene's sequence and Dr Campeau's sequence. The sequence differences do not affect GFP expression or general plasmid function. Backbone Size:8568; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Tet-On Advanced vector; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:08:14 2
pPSSUB-101
 
Resource Report
Resource Website 		RRID:Addgene_26580 destabilized GFP Aequorea victoria Chloramphenicol PMID:15096621 A novel hybrid promoter luxPRcI-OR1 (wild-type luxPR promoter with a CI OR1 operator site inserted at the +1 transcription start) drives expression of GFP(LVA). The promoter was constructed by encoding OR1 on PCR primers and inserting it after luxPR Backbone Size:0; Vector Backbone:pLuxI-tet8 + pRKM-102; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol S2R, C-terminal extension RPAANDENYA(LVA) Addgene 2026-10-31 02:08:14 0
pZS2-123
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26598 Synthetic Multiple synthetic genes Kanamycin PMID:20646328 Backbone Size:3288; Vector Backbone:pZS2; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin N/A Addgene 2026-10-31 02:08:14 6
pLKO.1 p18 shRNA
 
Resource Report
Resource Website 		RRID:Addgene_26631 p18 shRNA Homo sapiens Ampicillin PMID:20381137 shRNA directed against p18. Target sequence: 5'-AGACAGCCAGCAACATCATTG-3' Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:08:14 0
pLJM1 Flag Raptor
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26633 raptor Homo sapiens Ampicillin PMID:20381137 Backbone Marker:Available at Addgene (#19319); Backbone Size:7400; Vector Backbone:pLJM1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:08:14 9
pSIH1-puro-control shRNA
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_26597 control shRNA Ampicillin PMID:20197401 Control shRNA: AATAGCGACTAAACACATCAATTCAAGAGATTGATGTGTTTAGTCGCTATTTTTTTT Backbone Marker:System Biosciences; Backbone Size:7200; Vector Backbone:pSIH1-H1-puro; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:08:14 18
pSIH1-puro-STAT3 shRNA
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_26596 STAT3 shRNA Homo sapiens Ampicillin PMID:20197401 STAT3 shRNA sequence: gatccGCATCTGCCTAGATCGGCTATTCAAGAGATAGCCGATCTAGGCAGATGTTTTTTg Backbone Marker:System Biosciences; Backbone Size:7200; Vector Backbone:pSIH1-H1-puro; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:08:14 16
pEGFP-C1-hRabin8 L196A
 
Resource Report
Resource Website 		RRID:Addgene_26727 Rabin8 Homo sapiens Kanamycin PMID:20890297 L196A mutant in GEF domain. Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin L196A: GEF domain mutant. Addgene 2026-10-31 02:08:15 0
D28 Cortactin GFP
 
Resource Report
Resource Website 		RRID:Addgene_26723 Cortactin Mus musculus Kanamycin PMID:16280362 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Deletion removed 28 amino acids (aa# 334-361) encompassing the four calpain cleavage sites. All four sites are located immediately following the last half repeat of the actin binding domain and before the {alpha}-helical domain. Addgene 2026-10-31 02:08:15 0
RFP-zyxin
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_26720 Zyxin Homo sapiens Kanamycin PMID:12154072 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pDsRed-N1; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin Addgene 2026-10-31 02:08:15 10
HHV6 U69
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26689 U69 Human Herpes Virus 6 Ampicillin PMID:20838604 U69 Accession No.: X83413.1 Backbone Size:5000; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:08:15 2
pCAG-YTB
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26721 venusYFP, TVA950, Rabies Glycoprotein Gallus gallus Ampicillin PMID:20797534 Please note that the Addgene sequencing result shows a CMV promoter is present. A CAG promoter was not identified as the plasmid name implies. Backbone Size:3520; Vector Backbone:pCAG-venusYFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:08:15 2
pCMVTNT-T7-KPNA7
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26683 Karyopherin Alpha 7 Homo sapiens Ampicillin PMID:20701745 Backbone Marker:Promega; Backbone Size:4050; Vector Backbone:pCMVTNT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:08:15 3
pET-30 Ubwt (2)
 
Resource Report
Resource Website 		RRID:Addgene_26685 Ubiquitin Saccharomyces cerevisiae Kanamycin PMID:19252184 Same sequence as human Ub, except: S19, D24; S28 Backbone Marker:EMD Biosciences; Backbone Size:5400; Vector Backbone:pET-30 Xa/Lic; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Addgene 2026-10-31 02:08:15 0
mRFP-UtrCH
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26739 Utrophin unknown Ampicillin PMID:17685442 The calponin homology domain of utrophin (Utr-CH) was fused to monomeric RFP in order to visualize F-actin. Backbone Size:4097; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, reporter for F-actin; Bacterial Resistance:Ampicillin Calponin homology domain of utrophin (aa# 1-261) Addgene 2026-10-31 02:08:15 4

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch