Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Axin2 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4800; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11809808
Comments: A 5.6-kb DNA fragment containing the Axin2 promoter, exon 1, intron 1, and part of exon 2 was subcloned from a mouse BAC clone and sequenced. In Author's map, exons are shown as gray boxes, and the sequence is numbered with bp 1 corresponding to the start of the cDNA sequence. Eight conserved Tcf/LEF
binding sites (underlined and designated T1 to T8) were identified.
Proper citation: RRID:Addgene_21275 Copy
Species: Mus musculus
Genetic Insert: Axin2
Vector Backbone Description: Backbone Size:4300; Vector Backbone:pCS2+MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11809808
Proper citation: RRID:Addgene_21279 Copy
Species: Mus musculus
Genetic Insert: Axin2
Vector Backbone Description: Backbone Size:0; Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11809808
Comments: Full-length Axin2 cDNA. Tong clone #99.
Proper citation: RRID:Addgene_21278 Copy
Species: Mus musculus
Genetic Insert: Int3
Vector Backbone Description: Backbone Size:6700; Vector Backbone:pLNC; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9576833
Proper citation: RRID:Addgene_21329 Copy
Species: Mus musculus
Genetic Insert: Axin
Vector Backbone Description: Backbone Size:4300; Vector Backbone:pCS2+MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9230313
Proper citation: RRID:Addgene_21287 Copy
Species: Mus musculus
Genetic Insert: Notch4
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2900; Vector Backbone:pBSKS; Vector Types:Cloning Vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8681805
Proper citation: RRID:Addgene_21325 Copy
Species: Mus musculus
Genetic Insert: Krox20-Myelin Specific Enhancer
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19179536
Comments: Plasmid 21261: Krox20-MSE8 pGL3-TATA sequence match with genomic sequences on Chromosome 10 upstream of Egr2. It's an enhancer of Egr2 localized ~35 kb downstream of the defined genomic sequence of Egr2. If comparing the genomic location of plasmid 21261 (Chromosome 10: 9367948-9368511) and plasmid 21260 (Chromosome 10: 9331837-9332418), one can see that it's approximately 35 kb apart.
Proper citation: RRID:Addgene_21261 Copy
Species: Mus musculus
Genetic Insert: Krox20 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19179536
Comments: There is a T to C mismatch with Krox20. The single mis-match of the nucleotide is likely to reflect the polymorphism of different mouse strain used in the cloning.
Proper citation: RRID:Addgene_21260 Copy
Species: Mus musculus
Genetic Insert: Notch4
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2900; Vector Backbone:pBSKS; Vector Types:Cloning Vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9576833
Proper citation: RRID:Addgene_21470 Copy
Species: Mus musculus
Genetic Insert: DEPTOR shRNA 2
Vector Backbone Description: Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19446321
Comments: mouse DEPTOR shRNA 2
TRCN0000110159; NM_145470.1-1165s1c1
shRNA oligo sequence is - 5'-CCGGGCAAGGAAGACATTCACGATTCTCGAGAATCGTGAATGTCTTCCTTGCTTTTTG
Proper citation: RRID:Addgene_21338 Copy
Species: Mus musculus
Genetic Insert: DEPTOR shRNA 1
Vector Backbone Description: Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19446321
Comments: mouse DEPTOR shRNA 1
TRCN0000110157; NM_145470.1-1164s1c1
shRNA oligo sequence is - 5'-CCGGCGCAAGGAAGACATTCACGATCTCGAGATCG
TGAATGTCTTCCTTGCGTTTTTG
Proper citation: RRID:Addgene_21337 Copy
Species: Mus musculus
Genetic Insert: Int3
Vector Backbone Description: Backbone Size:6700; Vector Backbone:pLHTC; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9576833
Proper citation: RRID:Addgene_21330 Copy
Species: Mus musculus
Genetic Insert: Hoxb7 promoter
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KS+; Vector Types:Promoter can be used to make transgenic mice; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10068631
Comments: Hoxb7 promoter #25, DNA #M126. The Hoxb7promoter fragment (sequences from −1316 to +81 of the Hoxb7gene), obtained from Dr Jacqueline Deschamps, was excised from the pGEM-Blue vector with KpnI and AvaI,
the ends blunted, and recloned into the EcoRV site of pBluescript KS+ in both orientations.
Proper citation: RRID:Addgene_21294 Copy
Species: Mus musculus
Genetic Insert: rictor shRNA 1
Vector Backbone Description: Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19150980
Comments: mouse rictor shRNA 1
shRNA oligo sequence is 5'- CCGGGCCAGTAAGATGGGAATCATTCTCGAGAATGATTCCCATCTTACTGGCTTTTTG -3'
Proper citation: RRID:Addgene_21341 Copy
Species: Mus musculus
Genetic Insert: raptor shRNA 2
Vector Backbone Description: Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19446321
Comments: mouse raptor shRNA 2
shRNA oligo sequence is 5'- CCGGGCCCGAGTCTGTGAATGTAATCTCGAGATTACATTCACAGACTCGGGCTTTTTG -3'
Proper citation: RRID:Addgene_21340 Copy
Species: Mus musculus
Genetic Insert: Notch4
Vector Backbone Description: Backbone Size:7600; Vector Backbone:pHyTc; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_21468 Copy
Species: Mus musculus
Genetic Insert: mitogen-activated protein kinase kinase 4
Vector Backbone Description: Backbone Marker:Bruce Mayer Lab; Backbone Size:6100; Vector Backbone:pEBG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7997269
Comments: missing first 10 amino acids
Proper citation: RRID:Addgene_21563 Copy
Species: Mus musculus
Genetic Insert: Stra8 promoter
Vector Backbone Description: Backbone Size:7048; Vector Backbone:pLLU2G; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18719224
Comments: This is a 3rd generation lentiviral plasmid.
Proper citation: RRID:Addgene_21619 Copy
Species: Mus musculus
Genetic Insert: Bmi-1
Vector Backbone Description: Backbone Marker:D. Baltimore; Backbone Size:9941; Vector Backbone:FUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18371338
Comments: Bmi-1 cDNA cloned into pIRES-eGFP first. The Bmi1-ires-eGFP was then cut out and cloned into FUGW.
Proper citation: RRID:Addgene_21577 Copy
Species: Mus musculus
Genetic Insert: TNF receptor-associated factor 6
Vector Backbone Description: Backbone Marker:Dr. David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15456887
Proper citation: RRID:Addgene_21624 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
