Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: zinc finger nuclease
Vector Backbone Description: Backbone Size:4760; Vector Backbone:CS2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18500337
Proper citation: RRID:Addgene_18755 Copy
Species: Mus musculus
Genetic Insert: 3 tandem zinc fingers
Vector Backbone Description: Backbone Size:3890; Vector Backbone:ColE1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:18500337
Proper citation: RRID:Addgene_18756 Copy
Species: Mus musculus
Genetic Insert: thioredoxin-interacting protein
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16301999
Proper citation: RRID:Addgene_18758 Copy
Species: Mus musculus
Genetic Insert: Sidekick-2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:pEGFP-N1 (EGFP deleted); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18216854
Comments: The NdeI-NotI fragment obtained from mKIAA1514 plasmid was cloned into the XhoI and NotI sites of EGFP-N1, and the XhoI-NdeI fragment was replaced by a cDNA amplified with primers GGCCCTCGAGTTATAAAGCAACTCGCAAAGAGG and CTGTTGTAGGCAGCCACCTCGATC.
Proper citation: RRID:Addgene_18735 Copy
Species: Mus musculus
Genetic Insert: Dscam
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:pEGFP-N1 (EGFP deleted); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18216854
Comments: An AccI-NotI fragment from IMAGE clone 6410759 (ATCC) was cloned into the SalI/NotI sites of EGFP-N1. The AccI-AccI fragment was then replaced with cDNA amplified from mouse brain using primers GGCCGTCGACGTGGCTCGCTCGCTGGCTCGCTGGCT and CGACTCCAGCCGAGTTGTTGGCAGT.
Proper citation: RRID:Addgene_18737 Copy
Species: Mus musculus
Genetic Insert: TRPML2
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16606612
Proper citation: RRID:Addgene_18830 Copy
Species: Mus musculus
Genetic Insert: TRPML2
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16606612
Proper citation: RRID:Addgene_18831 Copy
Species: Mus musculus
Genetic Insert: TRPML3
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16606612
Proper citation: RRID:Addgene_18832 Copy
Species: Mus musculus
Genetic Insert: TRPML3
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16606612
Proper citation: RRID:Addgene_18834 Copy
Species: Mus musculus
Genetic Insert: E-cadherin
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pWZL-Blast; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18483246
Comments: Full-length murine E-cadherin cDNA cloned into pWZL blast.
Proper citation: RRID:Addgene_18804 Copy
Species: Mus musculus
Genetic Insert: N-Cadherin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1 (Clontech); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17765678
Proper citation: RRID:Addgene_18870 Copy
Species: Mus musculus
Genetic Insert: ABCb10 lacking the mitochondrial targetting sequence
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15215243
Proper citation: RRID:Addgene_19034 Copy
Species: Mus musculus
Genetic Insert: wingless-related MMTV integration site 1
Vector Backbone Description: Backbone Size:7664; Vector Backbone:HIV-Zsgreen; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18371425
Comments: The Wnt1HA insert was cloned into the XbaI site of HIV-Zsgreen in order to generate a bicistronic lentivirus that coexpresses Wnt1HA with Zsgreen under the control of the EF1alpha promoter. Gerrit Dijkgraaf in Zena Werb's lab cloned this virus.
Proper citation: RRID:Addgene_18983 Copy
Species: Mus musculus
Genetic Insert: microRNA 106a-25
Vector Backbone Description: Backbone Size:0; Vector Backbone:pKS-DTA; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18329372
Proper citation: RRID:Addgene_19030 Copy
Species: Mus musculus
Genetic Insert: ATP-binding cassette, sub-family B (MDR/TAP), member 10
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6092; Vector Backbone:pIRES; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15215243
Proper citation: RRID:Addgene_19031 Copy
Species: Mus musculus
Genetic Insert: TAZ
Vector Backbone Description: Backbone Size:5800; Vector Backbone:pEF-BOS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11118213
Comments: The murine TAZ cDNA was subcloned into pEF-BOS lacking the SV40 origin (Mizushima and Nagata, 1990) to generate pEF-TAZ. A Flag tag was inserted into the N-terminus of mTAZ cDNA by PCR, and cloned into pEF-BOS to create pEF-TAZ-N-Flag.
Proper citation: RRID:Addgene_19025 Copy
Species: Mus musculus
Genetic Insert: microRNA 17-92
Vector Backbone Description: Backbone Size:0; Vector Backbone:pKOII; Vector Types:Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18329372
Proper citation: RRID:Addgene_19029 Copy
Species: Mus musculus
Genetic Insert: microRNA 106a-363
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KS(+); Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18329372
Proper citation: RRID:Addgene_19028 Copy
Species: Mus musculus
Genetic Insert: ADAM17
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17389606
Proper citation: RRID:Addgene_19141 Copy
Species: Mus musculus
Genetic Insert: ADAM10
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7200; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17389606
Proper citation: RRID:Addgene_19138 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
