Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
Axin2-luciferase Resource Report Resource Website 1+ mentions |
RRID:Addgene_21275 | Axin2 promoter | Mus musculus | Ampicillin | PMID:11809808 | A 5.6-kb DNA fragment containing the Axin2 promoter, exon 1, intron 1, and part of exon 2 was subcloned from a mouse BAC clone and sequenced. In Author's map, exons are shown as gray boxes, and the sequence is numbered with bp 1 corresponding to the start of the cDNA sequence. Eight conserved Tcf/LEF binding sites (underlined and designated T1 to T8) were identified. | Backbone Marker:Promega; Backbone Size:4800; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:01 | 7 | |
|
Myc-Axin2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_21279 | Axin2 | Mus musculus | Ampicillin | PMID:11809808 | Backbone Size:4300; Vector Backbone:pCS2+MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:01 | 2 | ||
|
Axin2 full length cDNA Resource Report Resource Website |
RRID:Addgene_21278 | Axin2 | Mus musculus | Ampicillin | PMID:11809808 | Full-length Axin2 cDNA. Tong clone #99. | Backbone Size:0; Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:01 | 0 | |
|
pLNC Int3HA Resource Report Resource Website |
RRID:Addgene_21329 | Int3 | Mus musculus | Ampicillin | PMID:9576833 | Backbone Size:6700; Vector Backbone:pLNC; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:02 | 0 | ||
|
pCS2-MT mouse Axin (Axin MTFu1) Resource Report Resource Website 1+ mentions |
RRID:Addgene_21287 | Axin | Mus musculus | Ampicillin | PMID:9230313 | Backbone Size:4300; Vector Backbone:pCS2+MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:01 | 3 | ||
|
pBSKS Notch4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_21325 | Notch4 | Mus musculus | Ampicillin | PMID:8681805 | Backbone Marker:Stratagene; Backbone Size:2900; Vector Backbone:pBSKS; Vector Types:Cloning Vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:02 | 1 | ||
|
Krox20-MSE8 pGL3-TATA Resource Report Resource Website 1+ mentions |
RRID:Addgene_21261 | Krox20-Myelin Specific Enhancer | Mus musculus | Ampicillin | PMID:19179536 | Plasmid 21261: Krox20-MSE8 pGL3-TATA sequence match with genomic sequences on Chromosome 10 upstream of Egr2. It's an enhancer of Egr2 localized ~35 kb downstream of the defined genomic sequence of Egr2. If comparing the genomic location of plasmid 21261 (Chromosome 10: 9367948-9368511) and plasmid 21260 (Chromosome 10: 9331837-9332418), one can see that it's approximately 35 kb apart. | Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:01 | 2 | |
|
Krox20 promoter pGL3-TATA Resource Report Resource Website 1+ mentions |
RRID:Addgene_21260 | Krox20 promoter | Mus musculus | Ampicillin | PMID:19179536 | There is a T to C mismatch with Krox20. The single mis-match of the nucleotide is likely to reflect the polymorphism of different mouse strain used in the cloning. | Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:01 | 2 | |
|
pBS Notch4HA Resource Report Resource Website |
RRID:Addgene_21470 | Notch4 | Mus musculus | Ampicillin | PMID:9576833 | Backbone Marker:Stratagene; Backbone Size:2900; Vector Backbone:pBSKS; Vector Types:Cloning Vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:02 | 0 | ||
|
pLKO mouse shRNA 2 DEPTOR Resource Report Resource Website 1+ mentions |
RRID:Addgene_21338 | DEPTOR shRNA 2 | Mus musculus | Ampicillin | PMID:19446321 | mouse DEPTOR shRNA 2 TRCN0000110159; NM_145470.1-1165s1c1 shRNA oligo sequence is - 5'-CCGGGCAAGGAAGACATTCACGATTCTCGAGAATCGTGAATGTCTTCCTTGCTTTTTG | Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:02 | 2 | |
|
pLKO mouse shRNA 1 DEPTOR Resource Report Resource Website 1+ mentions |
RRID:Addgene_21337 | DEPTOR shRNA 1 | Mus musculus | Ampicillin | PMID:19446321 | mouse DEPTOR shRNA 1 TRCN0000110157; NM_145470.1-1164s1c1 shRNA oligo sequence is - 5'-CCGGCGCAAGGAAGACATTCACGATCTCGAGATCG TGAATGTCTTCCTTGCGTTTTTG | Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:02 | 3 | |
|
pLHTC Int3HA Resource Report Resource Website |
RRID:Addgene_21330 | Int3 | Mus musculus | Ampicillin | PMID:9576833 | Backbone Size:6700; Vector Backbone:pLHTC; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:02 | 0 | ||
|
Hoxb7 promoter Resource Report Resource Website |
RRID:Addgene_21294 | Hoxb7 promoter | Mus musculus | Ampicillin | PMID:10068631 | Hoxb7 promoter #25, DNA #M126. The Hoxb7promoter fragment (sequences from −1316 to +81 of the Hoxb7gene), obtained from Dr Jacqueline Deschamps, was excised from the pGEM-Blue vector with KpnI and AvaI, the ends blunted, and recloned into the EcoRV site of pBluescript KS+ in both orientations. | Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KS+; Vector Types:Promoter can be used to make transgenic mice; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:01 | 0 | |
|
pLKO mouse shRNA 1 rictor Resource Report Resource Website 1+ mentions |
RRID:Addgene_21341 | rictor shRNA 1 | Mus musculus | Ampicillin | PMID:19150980 | mouse rictor shRNA 1 shRNA oligo sequence is 5'- CCGGGCCAGTAAGATGGGAATCATTCTCGAGAATGATTCCCATCTTACTGGCTTTTTG -3' | Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:02 | 9 | |
|
pLKO mouse shRNA 2 raptor Resource Report Resource Website 1+ mentions |
RRID:Addgene_21340 | raptor shRNA 2 | Mus musculus | Ampicillin | PMID:19446321 | mouse raptor shRNA 2 shRNA oligo sequence is 5'- CCGGGCCCGAGTCTGTGAATGTAATCTCGAGATTACATTCACAGACTCGGGCTTTTTG -3' | Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:02 | 4 | |
|
pHyTc Notch4 Resource Report Resource Website |
RRID:Addgene_21468 | Notch4 | Mus musculus | Ampicillin | Backbone Size:7600; Vector Backbone:pHyTc; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:02 | 0 | |||
|
pEBG-MKK4 (GST) Resource Report Resource Website 1+ mentions |
RRID:Addgene_21563 | mitogen-activated protein kinase kinase 4 | Mus musculus | Ampicillin | PMID:7997269 | missing first 10 amino acids | Backbone Marker:Bruce Mayer Lab; Backbone Size:6100; Vector Backbone:pEBG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:03 | 1 | |
|
pLSG (stra8) Resource Report Resource Website 1+ mentions |
RRID:Addgene_21619 | Stra8 promoter | Mus musculus | Ampicillin | PMID:18719224 | This is a 3rd generation lentiviral plasmid. | Backbone Size:7048; Vector Backbone:pLLU2G; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:04 | 1 | |
|
Bmi1-overexpression Resource Report Resource Website 1+ mentions |
RRID:Addgene_21577 | Bmi-1 | Mus musculus | Ampicillin | PMID:18371338 | Bmi-1 cDNA cloned into pIRES-eGFP first. The Bmi1-ires-eGFP was then cut out and cloned into FUGW. | Backbone Marker:D. Baltimore; Backbone Size:9941; Vector Backbone:FUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:03 | 1 | |
|
FLAG-TRAF6-wt Resource Report Resource Website 10+ mentions |
RRID:Addgene_21624 | TNF receptor-associated factor 6 | Mus musculus | Ampicillin | PMID:15456887 | Backbone Marker:Dr. David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:03 | 24 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
