Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
|||||
|---|---|---|---|---|---|---|---|---|---|---|---|
|
PaGFP-UtrCH Resource Report Resource Website 1+ mentions |
RRID:Addgene_26738 | Utrophin | unknown | Ampicillin | PMID:17685442 | The calponin homology domain of utrophin (Utr-CH) was fused to a photoactivatable form of GFP in order to visualize F-actin. | Backbone Size:4097; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, reporter for F-actin; Bacterial Resistance:Ampicillin | Calponin homology domain of utrophin (aa# 1-261) | Addgene | 2026-10-31 02:08:15 | 4 |
|
GFP-pGBD Resource Report Resource Website 1+ mentions |
RRID:Addgene_26735 | Rac | Xenopus laevis | Ampicillin | PMID:15684032 | Backbone Size:4097; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, reporter for Rac; Bacterial Resistance:Ampicillin | Rac binding domain of rhotekin | Addgene | 2026-10-31 02:08:15 | 2 | |
|
GFP-UtrCH Resource Report Resource Website 10+ mentions |
RRID:Addgene_26737 | Utrophin | unknown | Ampicillin | PMID:17685442 | Uploaded sequence from depositing lab includes the complete GFP-utrophin sequence. Please note that mutation Q236R in utrophin was found during Addgene's quality control. The mutation does NOT affect plasmid function. | Backbone Size:4097; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, reporter for F-actin; Bacterial Resistance:Ampicillin | Calponin homology domain of utrophin (aa# 1-261). See depositor comments below | Addgene | 2026-10-31 02:08:15 | 31 |
|
VZV ORF47 Resource Report Resource Website 1+ mentions |
RRID:Addgene_26698 | ORF47 | Varicella Zoster Virus (HHV-3) | Ampicillin | PMID:20838604 | ORF47 accession no.: AF314218.1 | Backbone Size:5000; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | A 3B3 epitope tag (DQRQYGDVFKGD) from the VZV gB protein is inserted at amino acid #50 | Addgene | 2026-10-31 02:08:15 | 2 |
|
HRE-luciferase Resource Report Resource Website 50+ mentions |
RRID:Addgene_26731 | Hypoxia Responsive Elements (3) | Ampicillin | PMID:18268343 | Three hypoxia response elements (24-mers) from the Pgk-1 gene upstream of firefly luciferase. HRE: TGTCACGTCCTGCACGACTCTAGT Note that one of the elements is a 22/24 match for the above sequence. This difference is not known to affect function. | Backbone Marker:Promega; Backbone Size:0; Vector Backbone:pGL2; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:08:15 | 90 | ||
|
HSV-1 UL13 Resource Report Resource Website 1+ mentions |
RRID:Addgene_26697 | UL13 | Herpes Simplex Virus type 1 | Ampicillin | PMID:20838604 | UL13 Accession No.: HM584913 | Backbone Size:5000; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:08:15 | 3 | |
|
pLenti CMV rtTA3 Hygro (w785-1) Resource Report Resource Website 10+ mentions |
RRID:Addgene_26730 | Tetracycline repressor A3 mutant | Ampicillin | This plasmid can be used to generate Tet-On advanced cell lines. It has been reported that it works better than other tetracycline repressor (Markusic et al. 2005). This plasmid has a mismatch in the first attB site. The consequences of this mismatch are not clear, however depositor successfully made 2 different cell lines with that construct. | Backbone Size:8669; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:08:15 | 35 | |||
|
p1242 3x-KB-L Resource Report Resource Website 10+ mentions |
RRID:Addgene_26699 | 3x MHC I KB element - luciferase | Homo sapiens | Ampicillin | PMID:7707523 | The plasmid 3X-KB-L has a minimal fos promoter element and three copies of the major histocompatibility complex (MHC) class I KB element TGGGGATTCCCCA. It was constructed by ligation of the fragment obtained through digestion of MHC-NF-KB CAT by HindIII, blunting with Klenow DNA polymerase, and then digestion with BamHI. The fragment was ligated to pGL2-Basic digest(SmaI+BglII). | Backbone Marker:Promega; Backbone Size:5600; Vector Backbone:pGL2-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:08:15 | 21 | |
|
GFP-rGBD Resource Report Resource Website 10+ mentions |
RRID:Addgene_26732 | rhotekin | Mus musculus | Ampicillin | PMID:15684032 | The RhoA-binding domain of rhotekin (rGBD) was fused to eGFP in order to visualize active RhoA | Backbone Size:4097; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, reporter for Rho; Bacterial Resistance:Ampicillin | RhoA binding domain of rhotekin | Addgene | 2026-10-31 02:08:15 | 13 |
|
KSHV ORF36 KD Resource Report Resource Website 1+ mentions |
RRID:Addgene_26696 | ORF36 | Kaposi's Sarcoma Associated Herpesvirus (HHV-8) | Ampicillin | PMID:20838604 | ORF36 accession no.: AF148805 | Backbone Size:5000; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Kinase deficient mutant Lys 108 mutated to Gln | Addgene | 2026-10-31 02:08:15 | 1 |
|
KSHV ORF36 Resource Report Resource Website 1+ mentions |
RRID:Addgene_26695 | ORF36 | Kaposi's Sarcoma Associated Herpesvirus (HHV-8) | Ampicillin | PMID:20838604 | ORF36 accession no.: AF148805 | Backbone Size:5000; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:08:15 | 2 | |
|
EBV BGLF4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_26691 | BGLF4 | Epstein Bar Virus (EBV) | Ampicillin | PMID:20838604 | BGLF4 Accession No.: DQ279927 | Backbone Size:5000; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:08:15 | 2 | |
|
pLKO.1-blast-cfRab8b_1 Resource Report Resource Website |
RRID:Addgene_26708 | dog Rab8b RNAi | C. familiaris (dog RNAi) | Ampicillin | PMID:20890297 | Dog Rab8b RNAi. Only matches dog. RNAi sequence is: 5'-GCGGGCAGAGCCAGGAATT-3' | Backbone Size:7000; Vector Backbone:pLKO.1-blast; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | Dog Rab8b RNAi | Addgene | 2026-10-31 02:08:15 | 0 |
|
pLKO.1-blast-cfTuba_1 Resource Report Resource Website |
RRID:Addgene_26717 | dog Tuba RNAi | C. familiaris (dog RNAi) | Ampicillin | PMID:20890297 | RNAi to dog Tuba, but also matches multiple species, including human. RNAi target sequence is: 5'-GGAAATATGCAGATGGTGA-3'. | Backbone Size:7000; Vector Backbone:pLKO.1-blast; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | Dog Tuba RNAi | Addgene | 2026-10-31 02:08:15 | 0 |
|
pLKO.1-puro-cfSec15A_5 Resource Report Resource Website |
RRID:Addgene_26716 | Dog Sec15A RNAi | C. familiaris (dog RNAi) | Ampicillin | PMID:20890297 | RNAi only matches dog Sec15A, does not match Sec15B. Does not match other species' Sec15A. RNAi target sequence is: 5'-GCACGGGTCATGATAGTTT-3'. | Backbone Size:7000; Vector Backbone:pLKO.1-puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | Dog Sec15A-specific RNAi. | Addgene | 2026-10-31 02:08:15 | 0 |
|
pEGFPc2 mAbp1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_26719 | Actin-binding Protein-1 | Mus musculus | Kanamycin | PMID:19910490 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Addgene | 2026-10-31 02:08:15 | 2 | ||
|
pLKO.1-blast-cfTuba_2 Resource Report Resource Website |
RRID:Addgene_26718 | dog Tuba RNAi | C. familiaris (dog RNAi) | Ampicillin | PMID:20890297 | RNAi to Dog Tuba (matches dog only). RNAi target sequence is: 5'-GCAGAGAAGTTAAAGGACA-3'. | Backbone Size:7000; Vector Backbone:pLKO.1-blast; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | Canine Tuba_2 RNAi | Addgene | 2026-10-31 02:08:15 | 0 |
|
pCMVTNT-T7-KPNA3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_26679 | Karyopherin Alpha 3 | Homo sapiens | Ampicillin | PMID:20701745 | Backbone Marker:Promega; Backbone Size:4050; Vector Backbone:pCMVTNT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:08:15 | 5 | ||
|
Exp-pcDNA3.2delCMV(EF1α-tTA/TetO-mCh-Rs1) Resource Report Resource Website |
RRID:Addgene_26797 | Rs1 | Homo sapiens | Ampicillin | PMID:21375737 | pcDNA3.2 expression vector with the majority of the CMV promoter deleted, and carrying the EF1α-tTA/TetO-mCh-Rs1 cassette flanked by insulator sequences | Backbone Marker:Invitrogen; Backbone Size:4879; Vector Backbone:pcDNA3.2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | D100A | Addgene | 2026-10-31 02:08:16 | 0 |
|
pLKO.1-blast-cfRab25_2 Resource Report Resource Website |
RRID:Addgene_26711 | dog Rab25 RNAi | C. familiaris (dog RNAi) | Ampicillin | PMID:20890297 | Matches dog and Panda Rab25. RNAi sequence is: 5'-AGAGATCTTCACCAAAGTG-3' | Backbone Size:7000; Vector Backbone:pLKO.1-blast; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | RNAi to canine Rab25. | Addgene | 2026-10-31 02:08:15 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
