Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 123 showing 2441 ~ 2460 out of 32,424 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_10706

    This resource has 1+ mentions.

http://www.addgene.org/10706

Species: Homo sapiens
Genetic Insert: FKHR
Vector Backbone Description: Backbone Size:4968; Vector Backbone:pGEX4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_10706 Copy   

http://www.addgene.org/107049

Species: Synthetic
Genetic Insert: SaCas9
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Comments: LacZ sgRNA for SaCas9

Proper citation: RRID:Addgene_107049 Copy   

http://www.addgene.org/10712

Species: Homo sapiens
Genetic Insert: Gamma adaptin 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: diagnostic digest with BamHI and EcoRI should release 2.1kb fragment.

Proper citation: RRID:Addgene_10712 Copy   

    • RRID:Addgene_10711

    This resource has 1+ mentions.

http://www.addgene.org/10711

Species: Homo sapiens
Genetic Insert: FKHRL1 AAA
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pSG5L; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12150827

Proper citation: RRID:Addgene_10711 Copy   

    • RRID:Addgene_107023

    This resource has 1+ mentions.

http://www.addgene.org/107023

Species: Other
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:derived from pX552 (Addgene# 60958); Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_107023 Copy   

http://www.addgene.org/107006

Species: Homo sapiens
Genetic Insert: CD274
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29246442

Proper citation: RRID:Addgene_107006 Copy   

    • RRID:Addgene_107004

    This resource has 1+ mentions.

http://www.addgene.org/107004

Species: Homo sapiens
Genetic Insert: CD274
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29246442

Proper citation: RRID:Addgene_107004 Copy   

    • RRID:Addgene_107003

    This resource has 1+ mentions.

http://www.addgene.org/107003

Species: Homo sapiens
Genetic Insert: CD274
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29246442

Proper citation: RRID:Addgene_107003 Copy   

    • RRID:Addgene_107000

    This resource has 1+ mentions.

http://www.addgene.org/107000

Species: Mus musculus
Genetic Insert: tristetraprolin
Vector Backbone Description: Backbone Marker:Thermo Scientific; Vector Backbone:pTRIPZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29246442
Comments: Please note- Addgene's quality control found one “g” nucleotide missing from the insert sequence. The depositor noted this "g" should make no difference to the function of plasmid, since it is located within an intron and will be spliced out.

Proper citation: RRID:Addgene_107000 Copy   

http://www.addgene.org/107009

Species: Homo sapiens
Genetic Insert: CD274
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29246442

Proper citation: RRID:Addgene_107009 Copy   

http://www.addgene.org/107055

Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_107055 Copy   

    • RRID:Addgene_107175

    This resource has 1+ mentions.

http://www.addgene.org/107175

Species: Other
Genetic Insert: TurboID (BirA mutant)
Vector Backbone Description: Vector Backbone:pLX304; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30125270
Comments: Please visit https://www.biorxiv.org/content/early/2017/10/02/196980 for BioRxiv preprint

Proper citation: RRID:Addgene_107175 Copy   

    • RRID:Addgene_107174

    This resource has 1+ mentions.

http://www.addgene.org/107174

Species: Other
Genetic Insert: miniTurbo (BirA mutant)
Vector Backbone Description: Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30125270
Comments: Please visit https://www.biorxiv.org/content/early/2017/10/02/196980 for BioRxiv preprint

Proper citation: RRID:Addgene_107174 Copy   

    • RRID:Addgene_107201

    This resource has 1+ mentions.

http://www.addgene.org/107201

Species: Homo sapiens
Genetic Insert: S100A11
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_107201 Copy   

    • RRID:Addgene_10719

    This resource has 1+ mentions.

http://www.addgene.org/10719

Species: Homo sapiens
Genetic Insert: p300 delta33
Vector Backbone Description: Backbone Marker:not the same as the commercial CMVb; Backbone Size:4800; Vector Backbone:CMVbeta; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: see author's map for pCMVb p300 wt for map of empty pCMVb vector.

Proper citation: RRID:Addgene_10719 Copy   

    • RRID:Addgene_10716

    This resource has 1+ mentions.

http://www.addgene.org/10716

Species: Homo sapiens
Genetic Insert: MARS
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: See author's map for cloning details. 2 BamHI sites in insert as well.

Proper citation: RRID:Addgene_10716 Copy   

    • RRID:Addgene_107140

    This resource has 1+ mentions.

http://www.addgene.org/107140

Species: Homo sapiens
Genetic Insert: HA-tagged Kras4B(G12V) and GFP
Vector Backbone Description: Backbone Size:11261; Vector Backbone:pLVET-IRES-GFP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28604746
Comments: K-RasG12V PCR:ed from pLenti-PGK-KRAS4B(G12V)(Addgene #35633) and ligated as PmeI/BamHI fragment into pLVET-IRES-GFP

Proper citation: RRID:Addgene_107140 Copy   

    • RRID:Addgene_107139

    This resource has 1+ mentions.

http://www.addgene.org/107139

Vector Backbone Description: Backbone Marker:Derived from pLVET-tTR-KRAB by P. Aebisher/D. Trono (Addgene plasmid #11644); Backbone Size:11261; Vector Backbone:pLVET; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28604746
Comments: pLVET-GFP-tTR-KRAB vector (Addgene#11644) was modified by first removing tTR-KRAB with EcoRI then ligating IRES-GFP from pMSCV PIG (Addgene #21654) as a blunt end PCR fragment into previously generated pLVET-GFP cut with SmaI. Finally original GFP was removed with EcoRI/MluI => ends blunted and vector religated to generate pLVET-IRES-GFP.

Proper citation: RRID:Addgene_107139 Copy   

    • RRID:Addgene_107146

    This resource has 1+ mentions.

http://www.addgene.org/107146

Species: Mus musculus
Genetic Insert: Ezh2
Vector Backbone Description: Backbone Size:6573; Vector Backbone:MSCV-IRES-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_107146 Copy   

    • RRID:Addgene_107145

    This resource has 10+ mentions.

http://www.addgene.org/107145

Species: Synthetic
Genetic Insert: GFP + sgRNA for GFP
Vector Backbone Description: Vector Backbone:pXPR_047; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Comments: gRNA sequence is GGTGAACCGCATCGAGCTGA pLKO TRC v2 library vector, Puro selection and eGFP expression.

Proper citation: RRID:Addgene_107145 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch