Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
1257 pGEX4T3 GST FKHR Resource Report Resource Website 1+ mentions |
RRID:Addgene_10706 | FKHR | Homo sapiens | Ampicillin | Backbone Size:4968; Vector Backbone:pGEX4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:06 | 3 | |||
|
pX601-miniCMV-SaCas9-U6-LacZvsSaCas9 sgRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_107049 | SaCas9 | Synthetic | Ampicillin | LacZ sgRNA for SaCas9 | Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:08 | 1 | ||
|
1552 pcDNA3 HA gamma adaptin 1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_10712 | Gamma adaptin 1 | Homo sapiens | Ampicillin | diagnostic digest with BamHI and EcoRI should release 2.1kb fragment. | Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:06 | 2 | ||
|
1342 pSG5L HA FKHRL1 AAA Resource Report Resource Website 1+ mentions |
RRID:Addgene_10711 | FKHRL1 AAA | Homo sapiens | Ampicillin | PMID:12150827 | Backbone Size:4000; Vector Backbone:pSG5L; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | AAA mutant (see map) | 2026-08-15 01:01:06 | 1 | |
|
pX552-GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_107023 | GFP | Other | Ampicillin | Backbone Marker:derived from pX552 (Addgene# 60958); Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:05 | 1 | |||
|
pGL3 1 kb prom and exon1 fragment CD274 Resource Report Resource Website 1+ mentions |
RRID:Addgene_107006 | CD274 | Homo sapiens | Ampicillin | PMID:29246442 | Backbone Marker:Promega; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:05 | 1 | ||
|
pGL3 3 kb prom. CD274 Resource Report Resource Website 1+ mentions |
RRID:Addgene_107004 | CD274 | Homo sapiens | Ampicillin | PMID:29246442 | Backbone Marker:Promega; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:05 | 3 | ||
|
pGL3 2 kb prom. CD274 Resource Report Resource Website 1+ mentions |
RRID:Addgene_107003 | CD274 | Homo sapiens | Ampicillin | PMID:29246442 | Backbone Marker:Promega; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:05 | 5 | ||
|
pTRIPZ Myc2-mouse TTP WT Resource Report Resource Website 1+ mentions |
RRID:Addgene_107000 | tristetraprolin | Mus musculus | Ampicillin | PMID:29246442 | Please note- Addgene's quality control found one “g” nucleotide missing from the insert sequence. The depositor noted this "g" should make no difference to the function of plasmid, since it is located within an intron and will be spliced out. | Backbone Marker:Thermo Scientific; Vector Backbone:pTRIPZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:05 | 1 | |
|
pGL3 3'UTR reporter WT 1.3 kb CD274 Hs 3'UTR Final Resource Report Resource Website 1+ mentions |
RRID:Addgene_107009 | CD274 | Homo sapiens | Ampicillin | PMID:29246442 | Backbone Marker:Promega; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:05 | 3 | ||
|
pX601 miniCMV-SaCas9-SpA-sgRNA scaffold Resource Report Resource Website 1+ mentions |
RRID:Addgene_107055 | Ampicillin | Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:06 | 5 | |||||
|
C1(1-29)-TurboID-V5_pLX304 Resource Report Resource Website 1+ mentions |
RRID:Addgene_107175 | TurboID (BirA mutant) | Other | Ampicillin | PMID:30125270 | Please visit https://www.biorxiv.org/content/early/2017/10/02/196980 for BioRxiv preprint | Vector Backbone:pLX304; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | Q65P, I87V, R118S, E140K, Q141R, S150G, L151P, V160A, T192A, K194I, M209V, M241T, S263P, I305V | 2026-08-15 01:01:07 | 2 |
|
C1(1-29)-miniTurbo-V5_pCDNA3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_107174 | miniTurbo (BirA mutant) | Other | Ampicillin | PMID:30125270 | Please visit https://www.biorxiv.org/content/early/2017/10/02/196980 for BioRxiv preprint | Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | aa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, S150G, L151P, V160A, T192A, K194I, M209V, I305V | 2026-08-15 01:01:07 | 3 |
|
GFP-S100A11 Resource Report Resource Website 1+ mentions |
RRID:Addgene_107201 | S100A11 | Homo sapiens | Kanamycin | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:01:09 | 1 | |||
|
1247 pCMVb p300 HA delta33 Resource Report Resource Website 1+ mentions |
RRID:Addgene_10719 | p300 delta33 | Homo sapiens | Ampicillin | see author's map for pCMVb p300 wt for map of empty pCMVb vector. | Backbone Marker:not the same as the commercial CMVb; Backbone Size:4800; Vector Backbone:CMVbeta; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Mutant does not bind to E1A. Amino acids 1737 to 1836 deleted. | 2026-08-15 01:01:09 | 2 | |
|
1533 pcDNA3 HA MARS Resource Report Resource Website 1+ mentions |
RRID:Addgene_10716 | MARS | Homo sapiens | Ampicillin | See author's map for cloning details. 2 BamHI sites in insert as well. | Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:07 | 1 | ||
|
pLVET-HA-K-RasG12V-IRES-GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_107140 | HA-tagged Kras4B(G12V) and GFP | Homo sapiens | Ampicillin | PMID:28604746 | K-RasG12V PCR:ed from pLenti-PGK-KRAS4B(G12V)(Addgene #35633) and ligated as PmeI/BamHI fragment into pLVET-IRES-GFP | Backbone Size:11261; Vector Backbone:pLVET-IRES-GFP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:09 | 2 | |
|
pLVET-IRES-GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_107139 | Ampicillin | PMID:28604746 | pLVET-GFP-tTR-KRAB vector (Addgene#11644) was modified by first removing tTR-KRAB with EcoRI then ligating IRES-GFP from pMSCV PIG (Addgene #21654) as a blunt end PCR fragment into previously generated pLVET-GFP cut with SmaI. Finally original GFP was removed with EcoRI/MluI => ends blunted and vector religated to generate pLVET-IRES-GFP. | Backbone Marker:Derived from pLVET-tTR-KRAB by P. Aebisher/D. Trono (Addgene plasmid #11644); Backbone Size:11261; Vector Backbone:pLVET; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:07 | 1 | |||
|
MSCV-mouse Ezh2-IRES-GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_107146 | Ezh2 | Mus musculus | Ampicillin | Backbone Size:6573; Vector Backbone:MSCV-IRES-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:09 | 2 | |||
|
pXPR_047 Resource Report Resource Website 10+ mentions |
RRID:Addgene_107145 | GFP + sgRNA for GFP | Synthetic | Ampicillin | gRNA sequence is GGTGAACCGCATCGAGCTGA pLKO TRC v2 library vector, Puro selection and eGFP expression. | Vector Backbone:pXPR_047; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:07 | 11 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
