Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Rous sarcoma virus (RSV)
Genetic Insert: RSV promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12165517
Comments: The Rous sarcoma virus (RSV) promoter reporter was constructed by isolating the RSV promoter from pRc/RSV (Invitrogen) via BglII and HindIII sites and cloned into pGL3-basic by the same sites.
Proper citation: RRID:Addgene_40343 Copy
Genetic Insert: 3xAP-1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12165517
Comments: The 3 AP-1 reporter contains three canonical AP-1 binding sites (TGACTCA) upstream of a minimal promoter fragment containing a TATA box in the luciferase reporter plasmid pGL3-basic.
Proper citation: RRID:Addgene_40342 Copy
Species: Homo sapiens
Genetic Insert: BCL-6Δ
Vector Backbone Description: Backbone Marker:Masafumi Tanaka and Winship Herr (PMID: 2302733); Backbone Size:7500; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10973278
Comments: The expression plasmid pCGN-BCL-6Δ was constructed by digesting the BCL-6 cDNA with EcoRI, deleting the 3' region, and cloning the remaining cDNA into pCGN. The BCL-6Δ is missing four of six zinc fingers and does not bind to a consensus BCL-6 probe in a gel shift assay (A. L. Dent, unpublished data).
Note, the cloning and ligation adds the following residues after aa595 of BCL6: RYQAYRYRRPGYR
Proper citation: RRID:Addgene_40338 Copy
Species: Homo sapiens
Genetic Insert: Pumilio homolog 2
Vector Backbone Description: Backbone Size:5372; Vector Backbone:pFRT/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20371350
Comments: Note that there are some cloning scars flanking the insert (see Addgene sequence), but they will not affect plasmid function.
Proper citation: RRID:Addgene_40292 Copy
Species: Homo sapiens
Genetic Insert: Calnexin
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23656278
Comments: Addgene sequencing results find I474N in calnexin translation compared to reference sequence NP_001737.1
Proper citation: RRID:Addgene_40290 Copy
Species: Mus musculus
Genetic Insert: MCP-1 promoter (mutated)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10973278
Comments: Note: Addgene NGS results identified an extra ~500 bp region upstream of the expected promoter, which contains a CMV enhancer feature. It is unknown what impact the region may have on plasmid function, but the extra sequence appears to have been present in the original sample received by Addgene.
A plasmid containing the mouse MCP-1 promoter driving luciferase (pMCP-Luc) was constructed from pGL3-basic (Promega, Madison, WI) and a PCR-generated MCP-1 promoter fragment. A proofreading competent Taq reagent (AccuTaq, Sigma) was used to ensure high fidelity PCR. 1.2 kb of the MCP-1 promoter (GenBank Accession no. U12470) was obtained by PCR of C57BL/6 mouse DNA with the following primers:
5′–TCATGTATATGGCTTTCCAGGTCT–3′ (sense strand, distal to transcription start)
5′–TGCACTTCTGGCTGCTCTGAG GCA–3′ (antisense strand, proximal to transcription start)
The PCR product terminates 28-bp downstream of the MCP-1 TATA site. XmaI and XhoI sites were added to the MCP-1 promoter by a second round of PCR with the primers:
5′–ATATCACCCGGGTCATGTATATGGCTTTCCAGGTCT–3′
5′–TAGATTCTCGAGTGCACTTCTGGCTGCTCTGAGGCA–3′
and XmaI and XhoI were used to clone the MCP-1 promoter fragment into pGL3-basic.
For the construction of the MCP-1 mutant promoter, the BCL-6 site was mutated by a two step PCR–based strategy using the above flanking primers and the following complementary primers to mutate the BCL-6 site:
5′–TCTCTCTTCCACTTCCT[TT]AAACA–3′
5′–TGTTT[AA]AGGAAGTGGAAGAGAGA–3′ (mutated bases are in brackets)
The mutant promoter was cloned into pGL3 via XhoI and XmaI. The wild-type and mutant MCP-1 promoter sequences were verified by sequencing.
Proper citation: RRID:Addgene_40325 Copy
Species: Mus musculus
Genetic Insert: 2C Promoter (2-cell stage promoter)
Vector Backbone Description: Backbone Marker:Invitrogen/Life Tech; Backbone Size:6400; Vector Backbone:pcDNA Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22722858
Comments: The CMV promoter from the parent pcDNA plasmid was removed with MluI and HindIII, leaving approx. 6400kb backbone. The 2C promoter was put in its place (730bp) using the same sites. Hence, the full plasmid is 7129bp. The promoter is active shortly after fertilization of mouse embryos to about the 8-cell stage. It is also on in a subset of MESCs & miPSCs.
Proper citation: RRID:Addgene_40281 Copy
Species: Synthetic
Genetic Insert: ddYFP-B
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4100; Vector Backbone:pBad-modified; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23656278
Proper citation: RRID:Addgene_40289 Copy
Vector Backbone Description: Backbone Size:6447; Vector Backbone:JDS94; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Backbone contains NNN/G 0.5 Domain
TAL N-terminal: ∆152 (Miller et al. 2011)
TAL C-terminus: +63 (Miller et al. 2011)
FOKI: ELD (-) heterodimer (Doyon et al. 2011)
Proper citation: RRID:Addgene_40322 Copy
Vector Backbone Description: Backbone Size:6447; Vector Backbone:JDS92; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Backbone contains SHD/C 0.5 Domain
TAL N-terminal: ∆152 (Miller et al. 2011)
TAL C-terminus: +63 (Miller et al. 2011)
FOKI: ELD (-) heterodimer (Doyon et al. 2011)
Proper citation: RRID:Addgene_40321 Copy
Species: Synthetic
Genetic Insert: ddGFP-B
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4100; Vector Backbone:pBad-modified; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23656278
Proper citation: RRID:Addgene_40287 Copy
Vector Backbone Description: Backbone Size:6447; Vector Backbone:JDS90; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Backbone contains SNI/A 0.5 Domain
TAL N-terminal: ∆152 (Miller et al. 2011)
TAL C-terminus: +63 (Miller et al. 2011)
FOKI: ELD (-) heterodimer (Doyon et al. 2011)
Proper citation: RRID:Addgene_40320 Copy
Genetic Insert: NaChBac
Vector Backbone Description: Backbone Size:8914; Vector Backbone:pUAST; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16407556
Proper citation: RRID:Addgene_40283 Copy
Species: Bacillus halodurans
Genetic Insert: NaChBac-EGFP
Vector Backbone Description: Backbone Size:8914; Vector Backbone:pUAST; Vector Types:Drosophila; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16407556
Proper citation: RRID:Addgene_40282 Copy
Vector Backbone Description: Backbone Size:6447; Vector Backbone:JDS88; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Backbone contains SNG/T 0.5 Domain
TAL N-terminal: ∆152 (Miller et al. 2011)
TAL C-terminus: +63 (Miller et al. 2011)
FOKI: KKR (+) heterodimer (Doyon et al. 2011)
Proper citation: RRID:Addgene_40319 Copy
Vector Backbone Description: Backbone Size:6447; Vector Backbone:JDS80; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Backbone contains SNI/A 0.5 Domain
TAL N-terminal: ∆152 (Miller et al. 2011)
TAL C-terminus: +63 (Miller et al. 2011)
FOKI: KKR (+) heterodimer (Doyon et al. 2011)
Proper citation: RRID:Addgene_40316 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: LEU2
Vector Backbone Description: Backbone Marker:ATCC, Number: 77142; Backbone Size:4967; Vector Backbone:pRS313; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23222782
Proper citation: RRID:Addgene_40276 Copy
Species: Homo sapiens
Genetic Insert: HTT partial exon 1 Q23
Vector Backbone Description: Backbone Marker:Roche; Backbone Size:5450; Vector Backbone:pHM6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10528852
Proper citation: RRID:Addgene_40263 Copy
Species: Homo sapiens
Genetic Insert: LRRK2
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pBACgus; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_40384 Copy
Species: Homo sapiens
Genetic Insert: LRRK2
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pBACgus; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_40383 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.