Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:ampicillin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

328,630 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
Gal4pBS2-Pleum
 
Resource Report
Resource Website 		RRID:Addgene_59992 promoter Saccharomyces cerevisiae Ampicillin PMID:22565375 Backbone Size:6000; Vector Backbone:p416; Vector Types:Yeast Expression, Synthetic Biology, Yeast synthetic hybrid promoter construct; Bacterial Resistance:Ampicillin 2026-08-15 01:17:28 0
RFN_EGFP_47
 
Resource Report
Resource Website 		RRID:Addgene_60071 pair of multiplex gRNAs targeting EGFP Ampicillin PMID:24770325 Left gRNA target site: AAGTTCAGCGTGTCCGGCGA Right gRNA target site: CCGTCCAGCTCGACCAGGAT Backbone Marker:Joung lab (Addgene plasmid # 53370); Vector Backbone:pSQT1313; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:17:28 0
GFP-CYLD-STOP
 
Resource Report
Resource Website 		RRID:Addgene_60077 Cylindromatosis Homo sapiens Ampicillin PMID:17495026 Backbone Marker:Life Technologies; Backbone Size:2600; Vector Backbone:pENTR; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:28 0
pLPNPX1
 
Resource Report
Resource Website 		RRID:Addgene_60126 Ampicillin Backbone Size:6600; Vector Backbone:pLNCX; Vector Types:Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:17:29 0
pHA AKT2 T309A/S474A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_60128 protein kinase B Homo sapiens Ampicillin Backbone Size:6600; Vector Backbone:pLNCX; Vector Types:Retroviral; Bacterial Resistance:Ampicillin Serine 474 and Threonine 309 changed to alanines 2026-08-15 01:17:29 3
pNB649
 
Resource Report
Resource Website 		RRID:Addgene_60136 FLuc Photinus pyralis Ampicillin PMID:25232010 Backbone Size:5261; Vector Backbone:p406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin A4V 2026-08-15 01:17:29 0
pNB768
 
Resource Report
Resource Website 		RRID:Addgene_60139 CBG99 Synthetic Ampicillin PMID:25232010 Backbone Size:5261; Vector Backbone:p406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:29 0
pNB769
 
Resource Report
Resource Website 		RRID:Addgene_60138 CBR Synthetic Ampicillin PMID:25232010 Backbone Size:5261; Vector Backbone:p406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:29 0
pAAV-myrSNAP-CON
 
Resource Report
Resource Website 		RRID:Addgene_60099 SNAP-tag Synthetic Ampicillin PMID:25157152 Backbone Marker:custom; Backbone Size:4600; Vector Backbone:pAAV-CMV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:17:29 0
pNB697
 
Resource Report
Resource Website 		RRID:Addgene_60146 RdLuc Synthetic Ampicillin PMID:25232010 Backbone Size:5480; Vector Backbone:pIS385; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:29 0
pNB693
 
Resource Report
Resource Website 		RRID:Addgene_60145 YeLuc Synthetic Ampicillin PMID:25232010 Backbone Size:5480; Vector Backbone:pIS385; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:29 0
pNB682
 
Resource Report
Resource Website 		RRID:Addgene_60143 FLuc-yEVenus-PEST Photinus pyralis Ampicillin PMID:25232010 Backbone Size:5261; Vector Backbone:p406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin A4V 2026-08-15 01:17:29 0
pNB767
 
Resource Report
Resource Website 		RRID:Addgene_60159 FLuc Photinus pyralis Ampicillin PMID:25232010 Backbone Size:6357; Vector Backbone:p406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin A4V & S504G (no functional effect) 2026-08-15 01:17:29 0
pNB778
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_60154 CBG99 Synthetic Ampicillin PMID:25232010 Backbone Size:6260; Vector Backbone:p406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:29 1
mscv2.2-NAIP6
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_60202 NAIP6 Mus musculus Ampicillin PMID:21874021 Vector Backbone:mscv2.2; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:17:30 1
mscv2.2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_60206 Ampicillin PMID:21874021 Vector Backbone:mscv2.2; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:17:30 6
pcDNA_DiCre_60.F2
 
Resource Report
Resource Website 		RRID:Addgene_60208 Cre recombinase Homo sapiens Ampicillin PMID:14576331 Backbone Marker:Life Technologies; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin amino acids 2021-2112 of FRAP with a T2098L mutation; amino acids 60-343 of humanized version of Cre recombinase 2026-08-15 01:17:30 0
pNB783
 
Resource Report
Resource Website 		RRID:Addgene_60162 FLuc Photinus pyralis Ampicillin PMID:25232010 Backbone Size:5280; Vector Backbone:p406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin A4V & S504G (no functional effect) 2026-08-15 01:17:29 0
pNB789
 
Resource Report
Resource Website 		RRID:Addgene_60166 FLuc-yEVenus-PEST Photinus pyralis Ampicillin PMID:25232010 Backbone Size:5820; Vector Backbone:p406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin FLuc has A4V & S504G (no functional effect) 2026-08-15 01:17:29 0
pNB788
 
Resource Report
Resource Website 		RRID:Addgene_60165 FLuc-yEVenus Photinus pyralis Ampicillin PMID:25232010 Backbone Size:5820; Vector Backbone:p406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin FLuc has A4V & S504G (no functional effect) 2026-08-15 01:17:29 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch