Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Mentions:yes (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pLVX-IRES Hyg SMAD4
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_107128 SMAD4 Homo sapiens Ampicillin PMID:26898331 Vector Backbone:pLVX-IRES-Hyg; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:01:06 2
416 pSG5L HA RB del22
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_10721 RB del22 Homo sapiens Ampicillin PMID:9420334 EcoRI is an internal site as well. See author's map. To learn more about del22 mutant, see reference: Sellers WR, Rodgers JW, and Kaelin WG, PNAS 92:11544. Backbone Size:4000; Vector Backbone:pSG5L; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Deletion of exon 22 (aa738-775) 2026-08-15 01:01:09 2
413 pSG5L HA RB
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_10720 RB Homo sapiens Ampicillin PMID:9420334 Backbone Size:4000; Vector Backbone:pSG5L; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:01:07 12
ecAT3.10
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_107215 ecAT3.10 Synthetic Ampicillin PMID:29121644 Backbone Marker:modified from Invitrogen; Backbone Size:5000; Vector Backbone:pCMV(MinDis) [variant of pDisplay]; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:01:09 2
pCN-EF2132tet
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_107191 EF2132 Other Ampicillin PMID:29463653 Backbone Size:5750; Vector Backbone:pCN-50; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:01:07 4
MSGV1-1D3-28Z.1-3 mut
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_107227 1D3-28Z. 1-3 mut Synthetic Ampicillin PMID:20631379 Backbone Size:5586; Vector Backbone:MSGV1; Vector Types:Retroviral; Bacterial Resistance:Ampicillin None 2026-08-15 01:01:08 6
MSGV-1D3-28Z All ITAMs intact
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_107226 1D3-28Z All ITAMs intact Synthetic Ampicillin PMID:20631379 Backbone Size:5584; Vector Backbone:MSGV1; Vector Types:Retroviral; Bacterial Resistance:Ampicillin None 2026-08-15 01:01:09 8
p2T-CAG-KKHSaCas9-BlastR
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_107189 KKH SaCas9 Ampicillin PMID:30405244 Backbone Marker:Richard Sherwood Lab; Backbone Size:6637; Vector Backbone:p2T-CAG-MCS-BlastR; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin E782K/N968K/R1015H 2026-08-15 01:01:07 2
AAV-aCamkII-mCherry-P2A-Cre-WPRE-BGH-polyA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_107313 aCamkII-mCherry-P2A-Cre-WPRE-BGH-polyA Other Ampicillin PMID:29335603 Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:01:08 1
EF1α-scFv-p65-HSF1-T2A-EGFP-WPRE-PolyA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_107311 EF1α-scFv-p65-HSF1-T2A-EGFP-WPRE-PolyA Other Ampicillin PMID:29335603 Vector Backbone:Lentivirus; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:01:08 2
dSV40-NLS-dCas9-HA-NLS-NLS-10xGCN4
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_107310 dSV40-dCas9-10xGCN4 Other Ampicillin PMID:29335603 Vector Backbone:Lentivirus; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:01:08 2
pCSD_1xNLS-SaCas9-1xNLS-3xHA-1xNLS
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_107317 SaCas9 S. aureus Ampicillin PMID:30451839 Vector Backbone:pCSDest2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:01:08 1
RINS1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_107290 RINS1 Homo sapiens Kanamycin PMID:28366620 Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:01:08 2
pCSD_2xNLS-SpCas9WT-NLS-3xHA-NLS-SaCas9WT-2xNLS
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_107320 SpCas9-SaCas9 fusion Synthetic Ampicillin PMID:30451839 Vector Backbone:pCSDest2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin SpCas9 is fused to SaCas9 2026-08-15 01:01:08 1
RNA motif plasmid cloning backbone
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_107253 RNA motif plasmid cloning backbone Ampicillin PMID:29400715 Digest plasmid with BsmBI and ligate RNA motif of interest. The RNA motif of interest would be in the 3UTR and flanked by BoxB motifs. Oligo cloning can be performed similarly to sgRNA cloning. Primers to order: Primers (5'->3') F GCTT R AGCT Example to clone in motif IRE motif IRE motif: TAACACATTATCGGGAGCAGTGTCTTCCATAATGTATAA Primers to order F: GCTT TAACACATTATCGGGAGCAGTGTCTTCCATAATGTATAA R: AGCT TTATACATTATGGAAGACACTGCTCCCGATAATGTGTTA Vector Backbone:pLEX; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:01:08 5
6x Halo-EGFP- 2x PACT
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_107265 6x Halo-EGFP- 2x PACT Homo sapiens Ampicillin PMID:29097549 Vector Backbone:pERB219; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:01:08 1
pSB3C5-proD-B0032-E0051
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_107241 ProA-RBS(B0032)-Gemini (E0051) Synthetic Chloramphenicol PMID:20843779 Backbone Marker:http://parts.igem.org/Part:pSB3C5; Backbone Size:2738; Vector Backbone:pSB3C5; Vector Types:; Bacterial Resistance:Chloramphenicol 2026-08-15 01:01:08 1
pLX304-MARK3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_107235 MARK3 Ampicillin PMID:29431698 Please visit https://www.biorxiv.org/content/early/2017/02/09/107201 for bioRxiv preprint. Backbone Marker:Addgene; Vector Backbone:pLX304; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:01:08 1
pNP1 sfGFP toehold switch
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_107355 toehold 7 + sfGFP Ampicillin PMID:30083608 Backbone Marker:New England Biolabs (cloning vector); Backbone Size:2202; Vector Backbone:pNP1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:01:09 1
BASU RaPID plasmid
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_107250 BASU Synthetic Ampicillin PMID:29400715 The BASU protein sequence has 4 mutations relative to wild type Bacillus subtilis biotin ligase (Uniprot P0CI75): N terminal truncation of 65 aa, R124G, E323S and G325R. Vector Backbone:pLEX; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:01:08 10

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch