Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: MOR185-1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19261596
Proper citation: RRID:Addgene_22357 Copy
Species: Mus musculus
Genetic Insert: MOR203-1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19261596
Proper citation: RRID:Addgene_22359 Copy
Species: Mus musculus
Genetic Insert: MOR182-1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19261596
Proper citation: RRID:Addgene_22355 Copy
Species: Mus musculus
Genetic Insert: MOR140-1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19261596
Proper citation: RRID:Addgene_22350 Copy
Species: Mus musculus
Genetic Insert: MOR4-1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19261596
Proper citation: RRID:Addgene_22329 Copy
Species: Mus musculus
Genetic Insert: MOR33-1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19261596
Proper citation: RRID:Addgene_22338 Copy
Species: Mus musculus
Genetic Insert: MOR23-1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19261596
Proper citation: RRID:Addgene_22334 Copy
Species: Mus musculus
Genetic Insert: MOR31-1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19261596
Comments: The sequence I sent is a 100% match to AY317748 (a variant of MOR31-1) and is the variant we used in the paper. L178H and Y10D are apparent in other variants.
Proper citation: RRID:Addgene_22337 Copy
Species: Mus musculus
Genetic Insert: MOR5-1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19261596
Proper citation: RRID:Addgene_22330 Copy
Species: Mus musculus
Genetic Insert: MOR9-1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19261596
Proper citation: RRID:Addgene_22331 Copy
Species: Mus musculus
Genetic Insert: MOR15-1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19261596
Comments: This clone was originally identified as Olfr611, but upon resequencing, it is actually Olfr612.
Proper citation: RRID:Addgene_22332 Copy
Species: Mus musculus
Genetic Insert: MOR18-1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19261596
Proper citation: RRID:Addgene_22333 Copy
Species: Mus musculus
Genetic Insert: Seryl tRNA synthetase (SRS) – mouse cytoplasmic dynein microtubule binding domain (MTBD) fusion protein
Vector Backbone Description: Backbone Marker:EMD; Backbone Size:0; Vector Backbone:pET42a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_22388 Copy
Species: Mus musculus
Genetic Insert: Seryl tRNA synthetase (SRS) – mouse cytoplasmic dynein microtubule binding domain (MTBD) fusion protein
Vector Backbone Description: Backbone Marker:EMD; Backbone Size:0; Vector Backbone:pET42a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_22392 Copy
Species: Mus musculus
Genetic Insert: NEMO shRNA1
Vector Backbone Description: Backbone Marker:Available at Addgene (#12084); Backbone Size:7700; Vector Backbone:pSicoR PGK puro; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19847165
Comments: Mouse NEMO shRNA1 in pSicoReverse (Puromycin)
forward oligo:
TGGACATGCTGGGTGAAGAATTCAAGAGATTCTTCACCCAGCATGTCCTTTTTTC
reverse oligo :
TCGAGAAAAAAGGACATGCTGGGTGAAGAATCTCTTGAATTCTTCACCCAGCATGTCCA
Proper citation: RRID:Addgene_22505 Copy
Species: Mus musculus
Genetic Insert: PIF6APB
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5369; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19749742
Proper citation: RRID:Addgene_22474 Copy
Species: Mus musculus
Genetic Insert: PhyB NT
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5369; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19749742
Proper citation: RRID:Addgene_22471 Copy
Species: Mus musculus
Genetic Insert: mDia2
Vector Backbone Description: Backbone Marker:N/A; Backbone Size:3500; Vector Backbone:EF-BOS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10678165
Proper citation: RRID:Addgene_25407 Copy
Species: Mus musculus
Genetic Insert: Mirlet7b
Vector Backbone Description: Backbone Marker:University of Michigan Vector Core; Backbone Size:7650; Vector Backbone:pLentilox 3.7GFP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18957199
Comments: The last nucleotide in the Letb insert is G rather than A but will not affect function.
Proper citation: RRID:Addgene_25404 Copy
Species: Mus musculus
Genetic Insert: high mobility group AT-Hook 2
Vector Backbone Description: Backbone Marker:University of Michigan Vector Core; Backbone Size:7766; Vector Backbone:pLentilox RSV; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18957199
Comments: Please use the following link to view the backbone sequence:
http://www2.med.umich.edu/medschool/vcore/PlasmidList.cfm
Proper citation: RRID:Addgene_25406 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
