Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:mus musculus (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

12,959 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pCI-MOR185-1
 
Resource Report
Resource Website 		RRID:Addgene_22357 MOR185-1 Mus musculus Ampicillin PMID:19261596 Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:11 0
pCI-MOR203-1
 
Resource Report
Resource Website 		RRID:Addgene_22359 MOR203-1 Mus musculus Ampicillin PMID:19261596 Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:11 0
pCI-MOR182-1
 
Resource Report
Resource Website 		RRID:Addgene_22355 MOR182-1 Mus musculus Ampicillin PMID:19261596 Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:11 0
pCI-MOR140-1
 
Resource Report
Resource Website 		RRID:Addgene_22350 MOR140-1 Mus musculus Ampicillin PMID:19261596 Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:10 0
pCI-MOR4-1
 
Resource Report
Resource Website 		RRID:Addgene_22329 MOR4-1 Mus musculus Ampicillin PMID:19261596 Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:10 0
pCI-MOR33-1
 
Resource Report
Resource Website 		RRID:Addgene_22338 MOR33-1 Mus musculus Ampicillin PMID:19261596 Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:10 0
pCI-MOR23-1
 
Resource Report
Resource Website 		RRID:Addgene_22334 MOR23-1 Mus musculus Ampicillin PMID:19261596 Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:10 0
pCI-MOR31-1
 
Resource Report
Resource Website 		RRID:Addgene_22337 MOR31-1 Mus musculus Ampicillin PMID:19261596 The sequence I sent is a 100% match to AY317748 (a variant of MOR31-1) and is the variant we used in the paper. L178H and Y10D are apparent in other variants. Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:10 0
pCI-MOR5-1
 
Resource Report
Resource Website 		RRID:Addgene_22330 MOR5-1 Mus musculus Ampicillin PMID:19261596 Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:10 0
pCI-MOR9-1
 
Resource Report
Resource Website 		RRID:Addgene_22331 MOR9-1 Mus musculus Ampicillin PMID:19261596 Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:10 0
pCI-MOR15-1
 
Resource Report
Resource Website 		RRID:Addgene_22332 MOR15-1 Mus musculus Ampicillin PMID:19261596 This clone was originally identified as Olfr611, but upon resequencing, it is actually Olfr612. Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:10 0
pCI-MOR18-1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22333 MOR18-1 Mus musculus Ampicillin PMID:19261596 Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:10 1
SRS-MTBD(19/19), dimer, no myc, ux
 
Resource Report
Resource Website 		RRID:Addgene_22388 Seryl tRNA synthetase (SRS) – mouse cytoplasmic dynein microtubule binding domain (MTBD) fusion protein Mus musculus Kanamycin Backbone Marker:EMD; Backbone Size:0; Vector Backbone:pET42a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:12:11 0
SRS-MTBD(22/19)wt, dimer, plus myc tag
 
Resource Report
Resource Website 		RRID:Addgene_22392 Seryl tRNA synthetase (SRS) – mouse cytoplasmic dynein microtubule binding domain (MTBD) fusion protein Mus musculus Kanamycin Backbone Marker:EMD; Backbone Size:0; Vector Backbone:pET42a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:12:11 0
pSicoR (Puro) NEMO shRNA1
 
Resource Report
Resource Website 		RRID:Addgene_22505 NEMO shRNA1 Mus musculus Ampicillin PMID:19847165 Mouse NEMO shRNA1 in pSicoReverse (Puromycin) forward oligo: TGGACATGCTGGGTGAAGAATTCAAGAGATTCTTCACCCAGCATGTCCTTTTTTC reverse oligo : TCGAGAAAAAAGGACATGCTGGGTGAAGAATCTCTTGAATTCTTCACCCAGCATGTCCA Backbone Marker:Available at Addgene (#12084); Backbone Size:7700; Vector Backbone:pSicoR PGK puro; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-15 01:12:12 0
pAL101
 
Resource Report
Resource Website 		RRID:Addgene_22474 PIF6APB Mus musculus Ampicillin PMID:19749742 Backbone Marker:Invitrogen; Backbone Size:5369; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:12:12 0
pAL113
 
Resource Report
Resource Website 		RRID:Addgene_22471 PhyB NT Mus musculus Ampicillin PMID:19749742 Backbone Marker:Invitrogen; Backbone Size:5369; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin Y276H 2026-08-15 01:12:12 0
pEFmEGFP-mDia2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_25407 mDia2 Mus musculus Ampicillin PMID:10678165 Backbone Marker:N/A; Backbone Size:3500; Vector Backbone:EF-BOS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Encodes mDia2 2026-08-15 01:12:41 4
Let-7b-GFP
 
Resource Report
Resource Website 		RRID:Addgene_25404 Mirlet7b Mus musculus Ampicillin PMID:18957199 The last nucleotide in the Letb insert is G rather than A but will not affect function. Backbone Marker:University of Michigan Vector Core; Backbone Size:7650; Vector Backbone:pLentilox 3.7GFP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin None 2026-08-15 01:12:41 0
HMGA2(3'UTR DEL)+GFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_25406 high mobility group AT-Hook 2 Mus musculus Ampicillin PMID:18957199 Please use the following link to view the backbone sequence: http://www2.med.umich.edu/medschool/vcore/PlasmidList.cfm Backbone Marker:University of Michigan Vector Core; Backbone Size:7766; Vector Backbone:pLentilox RSV; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 3" UTR is absent 2026-08-15 01:12:43 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch