Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 126 showing 2501 ~ 2520 out of 328,630 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_60294

http://www.addgene.org/60294

Species: Homo sapiens
Genetic Insert: KIRREL3 enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr11; start: 126232858 end: 126233700 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCGTGTGGGAGAAAAGTCTTCA Rv primer used for cloning: TGCCTTGTGAATGGCAGAGGAG

Proper citation: RRID:Addgene_60294 Copy   


  • RRID:Addgene_60293

http://www.addgene.org/60293

Species: Homo sapiens
Genetic Insert: SLC30A8 enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr8; start: 118326349 end: 118327201 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCGGAGGTCAGAGTTGCCTACA Rv primer used for cloning: CATGGATTCAGGCCATTCCTGTCA

Proper citation: RRID:Addgene_60293 Copy   


  • RRID:Addgene_60298

http://www.addgene.org/60298

Species: Homo sapiens
Genetic Insert: EDN3 enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr20; start: 57374048 end: 57374748 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCCATTCAGAAGCCCTTTCC Rv primer used for cloning: TTCTGCACCCAGCTTTGTAAGAGG

Proper citation: RRID:Addgene_60298 Copy   


  • RRID:Addgene_60297

http://www.addgene.org/60297

Species: Homo sapiens
Genetic Insert: CDKAL1 enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr6; start: 20799028 end: 20800286 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCTGAGAGCGGATTTTACAGAT Rv primer used for cloning: AGCAAAAGCTGCCATGCCTA

Proper citation: RRID:Addgene_60297 Copy   


  • RRID:Addgene_60296

http://www.addgene.org/60296

Species: Homo sapiens
Genetic Insert: CDKN2BAS enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr9; start: 22123613 end: 22124279 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCTCTGCATAAATTCTTTGGAACA Rv primer used for cloning: GATCCACCCACCTTGGTTTCC

Proper citation: RRID:Addgene_60296 Copy   


http://www.addgene.org/60225

Genetic Insert: sgRNA
Vector Backbone Description: Backbone Size:2738; Vector Backbone:AAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25263330
Comments: Information for Cas9 mice: JAX Stock#024857 B6.129S-Gt(ROSA)26Sor/J Strain Common Name: Cre-dependent Cas9 mouse; Rosa26-LSL-Cas9 (http://jaxmice.jax.org/strain/024857.html) JAX Stock#024858 B6;129S(FVB)-Gt(ROSA)26Sor/J Strain Common Name: constitutively active Cas9 mouse; Rosa26-Cas9 (http://jaxmice.jax.org/strain/024858.html)

Proper citation: RRID:Addgene_60225 Copy   


http://www.addgene.org/60228

Genetic Insert: sgRNA
Vector Backbone Description: Backbone Size:2597; Vector Backbone:AAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25263330
Comments: Information for Cas9 mice: JAX Stock#024857 B6.129S-Gt(ROSA)26Sor/J Strain Common Name: Cre-dependent Cas9 mouse; Rosa26-LSL-Cas9 (http://jaxmice.jax.org/strain/024857.html) JAX Stock#024858 B6;129S(FVB)-Gt(ROSA)26Sor/J Strain Common Name: constitutively active Cas9 mouse; Rosa26-Cas9 (http://jaxmice.jax.org/strain/024858.html) NOTE: The CBh promoter is slightly truncated. There should be no effect on function.

Proper citation: RRID:Addgene_60228 Copy   


http://www.addgene.org/60227

Genetic Insert: sgRNA
Vector Backbone Description: Backbone Size:2597; Vector Backbone:AAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25263330
Comments: Information for Cas9 mice: JAX Stock#024857 B6.129S-Gt(ROSA)26Sor/J Strain Common Name: Cre-dependent Cas9 mouse; Rosa26-LSL-Cas9 (http://jaxmice.jax.org/strain/024857.html) JAX Stock#024858 B6;129S(FVB)-Gt(ROSA)26Sor/J Strain Common Name: constitutively active Cas9 mouse; Rosa26-Cas9 (http://jaxmice.jax.org/strain/024858.html)

Proper citation: RRID:Addgene_60227 Copy   


http://www.addgene.org/60226

Genetic Insert: sgRNA
Vector Backbone Description: Backbone Size:2597; Vector Backbone:AAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25263330
Comments: Information for Cas9 mice: JAX Stock#024857 B6.129S-Gt(ROSA)26Sor/J Strain Common Name: Cre-dependent Cas9 mouse; Rosa26-LSL-Cas9 (http://jaxmice.jax.org/strain/024857.html) JAX Stock#024858 B6;129S(FVB)-Gt(ROSA)26Sor/J Strain Common Name: constitutively active Cas9 mouse; Rosa26-Cas9 (http://jaxmice.jax.org/strain/024858.html)

Proper citation: RRID:Addgene_60226 Copy   


http://www.addgene.org/60220

Species: Mus musculus
Genetic Insert: TUT4
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25175028

Proper citation: RRID:Addgene_60220 Copy   


http://www.addgene.org/60234

Species: Homo sapiens
Genetic Insert: Argonaute2
Vector Backbone Description: Backbone Size:13918; Vector Backbone:pSLIK-Hygro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22503104

Proper citation: RRID:Addgene_60234 Copy   


  • RRID:Addgene_60239

http://www.addgene.org/60239

Genetic Insert: inmCherry
Vector Backbone Description: Backbone Size:6587; Vector Backbone:pUCHR; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26269177

Proper citation: RRID:Addgene_60239 Copy   


  • RRID:Addgene_60238

http://www.addgene.org/60238

Genetic Insert: inmCherry
Vector Backbone Description: Backbone Size:6419; Vector Backbone:pUCHR; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26269177

Proper citation: RRID:Addgene_60238 Copy   


http://www.addgene.org/60231

Genetic Insert: sgRNA
Vector Backbone Description: Backbone Size:2597; Vector Backbone:AAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25263330
Comments: Information for Cas9 mice: JAX Stock#024857 B6.129S-Gt(ROSA)26Sor/J Strain Common Name: Cre-dependent Cas9 mouse; Rosa26-LSL-Cas9 (http://jaxmice.jax.org/strain/024857.html) JAX Stock#024858 B6;129S(FVB)-Gt(ROSA)26Sor/J Strain Common Name: constitutively active Cas9 mouse; Rosa26-Cas9 (http://jaxmice.jax.org/strain/024858.html)

Proper citation: RRID:Addgene_60231 Copy   


http://www.addgene.org/60230

Genetic Insert: sgRNA
Vector Backbone Description: Backbone Size:2597; Vector Backbone:AAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25263330
Comments: Information for Cas9 mice: JAX Stock#024857 B6.129S-Gt(ROSA)26Sor/J Strain Common Name: Cre-dependent Cas9 mouse; Rosa26-LSL-Cas9 (http://jaxmice.jax.org/strain/024857.html) JAX Stock#024858 B6;129S(FVB)-Gt(ROSA)26Sor/J Strain Common Name: constitutively active Cas9 mouse; Rosa26-Cas9 (http://jaxmice.jax.org/strain/024858.html)

Proper citation: RRID:Addgene_60230 Copy   


http://www.addgene.org/60401

Species: Saccharomyces cerevisiae
Genetic Insert: TUB2
Vector Backbone Description: Vector Backbone:pRS424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24633327

Proper citation: RRID:Addgene_60401 Copy   


http://www.addgene.org/60367

Species: Escherichia coli
Genetic Insert: RNase HI-D10R-E48R
Vector Backbone Description: Backbone Size:5044; Vector Backbone:pICE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25030905

Proper citation: RRID:Addgene_60367 Copy   


  • RRID:Addgene_60365

    This resource has 10+ mentions.

http://www.addgene.org/60365

Species: Escherichia coli
Genetic Insert: RNase HI
Vector Backbone Description: Backbone Size:5044; Vector Backbone:pICE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25030905

Proper citation: RRID:Addgene_60365 Copy   


http://www.addgene.org/60403

Species: Saccharomyces cerevisiae
Genetic Insert: TUB2
Vector Backbone Description: Vector Backbone:pRS424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24633327
Comments: C-terminal tail is from TUBB6 (tubulin, beta 6 class V) according to HUGO nomenclature: http://www.genenames.org/genefamilies/TUB

Proper citation: RRID:Addgene_60403 Copy   


  • RRID:Addgene_60408

    This resource has 10+ mentions.

http://www.addgene.org/60408

Species: A. sativa, E. coli
Genetic Insert: iLID C530M
Vector Backbone Description: Backbone Marker:Qiagen; Backbone Size:4800; Vector Backbone:pQE-80L; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25535392

Proper citation: RRID:Addgene_60408 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X