Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: high mobility group AT-Hook 2
Vector Backbone Description: Backbone Marker:University of Michigan Vector Core; Backbone Size:7766; Vector Backbone:pLentilox RSV; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18957199
Comments: To view the backbone sequence please visit use the following link:
http://www2.med.umich.edu/medschool/vcore/PlasmidList.cfm
Proper citation: RRID:Addgene_25405 Copy
Species: Mus musculus
Genetic Insert: BAF53b
Vector Backbone Description: Backbone Marker:home made; Backbone Size:6000; Vector Backbone:Beta-actin/CMV-IRES-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17920018
Proper citation: RRID:Addgene_25459 Copy
Species: Mus musculus
Genetic Insert: BAF53(b+a)
Vector Backbone Description: Backbone Size:6000; Vector Backbone:Beta-actin/CMV-IRES-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17920018
Proper citation: RRID:Addgene_25462 Copy
Species: Mus musculus
Genetic Insert: BAF53(a+b)
Vector Backbone Description: Backbone Marker:home made; Backbone Size:6000; Vector Backbone:Beta-actin/CMV-IRES-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17920018
Proper citation: RRID:Addgene_25461 Copy
Species: Mus musculus
Genetic Insert: BAF53a
Vector Backbone Description: Backbone Marker:home made; Backbone Size:6000; Vector Backbone:Beta-actin/CMV-IRES-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17920018
Proper citation: RRID:Addgene_25460 Copy
Species: Mus musculus
Genetic Insert: mCherry-miR155-lacZalpha
Vector Backbone Description: Backbone Marker:unpublished; Backbone Size:6700; Vector Backbone:pMA2767; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19655272
Proper citation: RRID:Addgene_25439 Copy
Species: Mus musculus
Genetic Insert: Diap3
Vector Backbone Description: Backbone Size:3000; Vector Backbone:EF-BOS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11035012
Comments: The Q1091P mutation in the DAD region was not intentional and may have been a cloning error.
Proper citation: RRID:Addgene_25411 Copy
Species: Mus musculus
Genetic Insert: Pax3
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:6310; Vector Backbone:p3XFLAG-CMV-14; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_25427 Copy
Species: Mus musculus
Genetic Insert: mMCL1(T144D)
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBabe IRES puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19433446
Proper citation: RRID:Addgene_25388 Copy
Species: Mus musculus
Genetic Insert: diap3
Vector Backbone Description: Backbone Marker:clontech Invitrogen; Backbone Size:3000; Vector Backbone:YFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16361707
Proper citation: RRID:Addgene_25420 Copy
Species: Mus musculus
Genetic Insert: Gb2 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with U6-driven G beta 2 miR-shRNA
G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA
Proper citation: RRID:Addgene_25759 Copy
Species: Mus musculus
Genetic Insert: G alpha 12 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with U6-driven G alpha 12 miR-shRNA
G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT
Addgene sequence shows that this plasmid is missing the EcoRI site.
Proper citation: RRID:Addgene_25757 Copy
Species: Mus musculus
Genetic Insert: Nampt
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:PET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16783373
Proper citation: RRID:Addgene_25630 Copy
Species: Mus musculus
Genetic Insert: G alpha 13 and 12 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4641; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven G alpha 12 and 13 miR-shRNA
G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT
G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT
There are 3 minor changes between depositor's sequence and Addgene's sequence - An extra T between the TRE promoter and first shRNA; a 17nt stretch between the shRNAs is different but will not affect function; and a single nt change mutates an EcoRI site just beyond the 2nd shRNA but will again not affect function.
Proper citation: RRID:Addgene_25763 Copy
Species: Mus musculus
Genetic Insert: G alpha 13 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven G alpha 13 miR-shRNA
G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT
Addgene sequence shows that this plasmid is missing the SpeI site.
Proper citation: RRID:Addgene_25762 Copy
Species: Mus musculus
Genetic Insert: Gb2 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA
Addgene sequence shows that this plasmid is missing the SpeI site.
Proper citation: RRID:Addgene_25764 Copy
Species: Mus musculus
Genetic Insert: Gb2
Vector Backbone Description: Backbone Marker:Iain Fraser; Backbone Size:13217; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16945906
Comments: Lentivirus; Inducible TRE driven GFP-shRNA (GB2); Constitutive Ubi-c driven rtTA3-IRES-Neo
GB2 miR-shRNA: TGCTCATGTATTCCCACGACAA
Proper citation: RRID:Addgene_25746 Copy
Species: Mus musculus
Genetic Insert: G alpha 12 miR-shRNA
Vector Backbone Description: Backbone Marker:Iain Fraser; Backbone Size:12370; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16945906
Comments: pSLIK-Venus with G alpha 12 miR-shRNA
G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT
Proper citation: RRID:Addgene_25740 Copy
Species: Mus musculus
Genetic Insert: G alpha 13 and 12 miR-shRNA
Vector Backbone Description: Backbone Marker:Iain Fraser; Backbone Size:12752; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16945906
Comments: pSLIK-Venus with G alpha 12 and 13 miR-shRNA
G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT
G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT
There are 3 minor changes between depositor's sequence and Addgene's sequence - An extra T between the TRE promoter and first shRNA; a 17nt stretch between the shRNAs is different but will not affect function; and a single nt change mutates an EcoRI site just beyond the 2nd shRNA but will again not affect function.
Proper citation: RRID:Addgene_25742 Copy
Species: Mus musculus
Genetic Insert: MCL1
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19433446
Proper citation: RRID:Addgene_25717 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
