Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:ampicillin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

328,630 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pGL4.23 C3_8
 
Resource Report
Resource Website 		RRID:Addgene_60294 KIRREL3 enhancer Homo sapiens Ampicillin PMID:24413736 chromosome : chr11; start: 126232858 end: 126233700 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCGTGTGGGAGAAAAGTCTTCA Rv primer used for cloning: TGCCTTGTGAATGGCAGAGGAG Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:17:31 0
pGL4.23 C3_7
 
Resource Report
Resource Website 		RRID:Addgene_60293 SLC30A8 enhancer Homo sapiens Ampicillin PMID:24413736 chromosome : chr8; start: 118326349 end: 118327201 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCGGAGGTCAGAGTTGCCTACA Rv primer used for cloning: CATGGATTCAGGCCATTCCTGTCA Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:17:31 0
pGL4.23 C3_13
 
Resource Report
Resource Website 		RRID:Addgene_60298 EDN3 enhancer Homo sapiens Ampicillin PMID:24413736 chromosome : chr20; start: 57374048 end: 57374748 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCCATTCAGAAGCCCTTTCC Rv primer used for cloning: TTCTGCACCCAGCTTTGTAAGAGG Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:17:31 0
pGL4.23 C3_11
 
Resource Report
Resource Website 		RRID:Addgene_60297 CDKAL1 enhancer Homo sapiens Ampicillin PMID:24413736 chromosome : chr6; start: 20799028 end: 20800286 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCTGAGAGCGGATTTTACAGAT Rv primer used for cloning: AGCAAAAGCTGCCATGCCTA Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:17:31 0
pGL4.23 C3_21
 
Resource Report
Resource Website 		RRID:Addgene_60296 CDKN2BAS enhancer Homo sapiens Ampicillin PMID:24413736 chromosome : chr9; start: 22123613 end: 22124279 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCTCTGCATAAATTCTTTGGAACA Rv primer used for cloning: GATCCACCCACCTTGGTTTCC Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:17:31 0
AAV:ITR-U6-sgRNA(LacZ)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR
 
Resource Report
Resource Website 		RRID:Addgene_60225 sgRNA Ampicillin PMID:25263330 Information for Cas9 mice: JAX Stock#024857 B6.129S-Gt(ROSA)26Sor/J Strain Common Name: Cre-dependent Cas9 mouse; Rosa26-LSL-Cas9 (http://jaxmice.jax.org/strain/024857.html) JAX Stock#024858 B6;129S(FVB)-Gt(ROSA)26Sor/J Strain Common Name: constitutively active Cas9 mouse; Rosa26-Cas9 (http://jaxmice.jax.org/strain/024858.html) Backbone Size:2738; Vector Backbone:AAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:17:30 0
AAV:ITR-U6-sgRNA(LacZ)-pCBh-Cre-WPRE-hGHpA-ITR
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_60228 sgRNA Ampicillin PMID:25263330 Information for Cas9 mice: JAX Stock#024857 B6.129S-Gt(ROSA)26Sor/J Strain Common Name: Cre-dependent Cas9 mouse; Rosa26-LSL-Cas9 (http://jaxmice.jax.org/strain/024857.html) JAX Stock#024858 B6;129S(FVB)-Gt(ROSA)26Sor/J Strain Common Name: constitutively active Cas9 mouse; Rosa26-Cas9 (http://jaxmice.jax.org/strain/024858.html) NOTE: The CBh promoter is slightly truncated. There should be no effect on function. Backbone Size:2597; Vector Backbone:AAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:17:30 2
AAV:ITR-U6-sgRNA(NeuN)-pCBh-Cre-WPRE-hGHpA-ITR
 
Resource Report
Resource Website 		RRID:Addgene_60227 sgRNA Ampicillin PMID:25263330 Information for Cas9 mice: JAX Stock#024857 B6.129S-Gt(ROSA)26Sor/J Strain Common Name: Cre-dependent Cas9 mouse; Rosa26-LSL-Cas9 (http://jaxmice.jax.org/strain/024857.html) JAX Stock#024858 B6;129S(FVB)-Gt(ROSA)26Sor/J Strain Common Name: constitutively active Cas9 mouse; Rosa26-Cas9 (http://jaxmice.jax.org/strain/024858.html) Backbone Size:2597; Vector Backbone:AAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:17:30 0
AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_60226 sgRNA Ampicillin PMID:25263330 Information for Cas9 mice: JAX Stock#024857 B6.129S-Gt(ROSA)26Sor/J Strain Common Name: Cre-dependent Cas9 mouse; Rosa26-LSL-Cas9 (http://jaxmice.jax.org/strain/024857.html) JAX Stock#024858 B6;129S(FVB)-Gt(ROSA)26Sor/J Strain Common Name: constitutively active Cas9 mouse; Rosa26-Cas9 (http://jaxmice.jax.org/strain/024858.html) Backbone Size:2597; Vector Backbone:AAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:17:30 3
pCI-FLAG-mTUT4(D1028A)
 
Resource Report
Resource Website 		RRID:Addgene_60220 TUT4 Mus musculus Ampicillin PMID:25175028 Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin D1028A 2026-08-15 01:17:30 0
pSLIK-Hygro-Myc-hAgo2
 
Resource Report
Resource Website 		RRID:Addgene_60234 Argonaute2 Homo sapiens Ampicillin PMID:22503104 Backbone Size:13918; Vector Backbone:pSLIK-Hygro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:17:30 0
pUCHR-inmCherry
 
Resource Report
Resource Website 		RRID:Addgene_60239 inmCherry Ampicillin PMID:26269177 Backbone Size:6587; Vector Backbone:pUCHR; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:17:30 0
pCRU5-inmCherry
 
Resource Report
Resource Website 		RRID:Addgene_60238 inmCherry Ampicillin PMID:26269177 Backbone Size:6419; Vector Backbone:pUCHR; Vector Types:Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:17:30 0
AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_60231 sgRNA Ampicillin PMID:25263330 Information for Cas9 mice: JAX Stock#024857 B6.129S-Gt(ROSA)26Sor/J Strain Common Name: Cre-dependent Cas9 mouse; Rosa26-LSL-Cas9 (http://jaxmice.jax.org/strain/024857.html) JAX Stock#024858 B6;129S(FVB)-Gt(ROSA)26Sor/J Strain Common Name: constitutively active Cas9 mouse; Rosa26-Cas9 (http://jaxmice.jax.org/strain/024858.html) Backbone Size:2597; Vector Backbone:AAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:17:30 23
AAV:ITR-U6-sgRNA(NeuN)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR
 
Resource Report
Resource Website 		RRID:Addgene_60230 sgRNA Ampicillin PMID:25263330 Information for Cas9 mice: JAX Stock#024857 B6.129S-Gt(ROSA)26Sor/J Strain Common Name: Cre-dependent Cas9 mouse; Rosa26-LSL-Cas9 (http://jaxmice.jax.org/strain/024857.html) JAX Stock#024858 B6;129S(FVB)-Gt(ROSA)26Sor/J Strain Common Name: constitutively active Cas9 mouse; Rosa26-Cas9 (http://jaxmice.jax.org/strain/024858.html) Backbone Size:2597; Vector Backbone:AAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:17:30 0
pRS424-TUB2 - human TUBB8 Cterminal tail
 
Resource Report
Resource Website 		RRID:Addgene_60401 TUB2 Saccharomyces cerevisiae Ampicillin PMID:24633327 Vector Backbone:pRS424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin TUB2 amino acids 429 - end, replaced with human TUBB8 sequence 2026-08-15 01:17:32 0
pICE-RNaseHI-D10R-E48R-NLS-mCherry
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_60367 RNase HI-D10R-E48R Escherichia coli Ampicillin PMID:25030905 Backbone Size:5044; Vector Backbone:pICE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin D10R+E48R; catalyticaly inactive 2026-08-15 01:17:32 12
pICE-RNaseHI-WT-NLS-mCherry
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_60365 RNase HI Escherichia coli Ampicillin PMID:25030905 Backbone Size:5044; Vector Backbone:pICE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:31 17
pRS424-TUB2 - human TUBB6 Cterminal tail
 
Resource Report
Resource Website 		RRID:Addgene_60403 TUB2 Saccharomyces cerevisiae Ampicillin PMID:24633327 C-terminal tail is from TUBB6 (tubulin, beta 6 class V) according to HUGO nomenclature: http://www.genenames.org/genefamilies/TUB Vector Backbone:pRS424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin TUB2 amino acids 429 - end, replaced with human TUBB6 sequence 2026-08-15 01:17:32 0
pQE-80L iLID (C530M)
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_60408 iLID C530M A. sativa, E. coli Ampicillin PMID:25535392 Backbone Marker:Qiagen; Backbone Size:4800; Vector Backbone:pQE-80L; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin C530M 2026-08-15 01:17:32 10

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch