Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Organism:mus musculus (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

12,959 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
HMGA2+GFP
 
Resource Report
Resource Website
RRID:Addgene_25405 high mobility group AT-Hook 2 Mus musculus Ampicillin PMID:18957199 To view the backbone sequence please visit use the following link: http://www2.med.umich.edu/medschool/vcore/PlasmidList.cfm Backbone Marker:University of Michigan Vector Core; Backbone Size:7766; Vector Backbone:pLentilox RSV; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin polyadenylation signal lacking 2026-08-15 01:12:41 0
Actin-53b-ires-EGFP
 
Resource Report
Resource Website
RRID:Addgene_25459 BAF53b Mus musculus Ampicillin PMID:17920018 Backbone Marker:home made; Backbone Size:6000; Vector Backbone:Beta-actin/CMV-IRES-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:41 0
Actin-BAF53(b+a)-ires-EGFP
 
Resource Report
Resource Website
RRID:Addgene_25462 BAF53(b+a) Mus musculus Ampicillin PMID:17920018 Backbone Size:6000; Vector Backbone:Beta-actin/CMV-IRES-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 3' of mBAF53b deleted and fused to 3' of mBAF53a 2026-08-15 01:12:41 0
Actin-BAF53(a+b)-ires-EGFP
 
Resource Report
Resource Website
RRID:Addgene_25461 BAF53(a+b) Mus musculus Ampicillin PMID:17920018 Backbone Marker:home made; Backbone Size:6000; Vector Backbone:Beta-actin/CMV-IRES-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 3' of mBAF53a deleted and fused to 3' of mBAF53b 2026-08-15 01:12:44 0
Actin-53a-ires-EGFP
 
Resource Report
Resource Website
RRID:Addgene_25460 BAF53a Mus musculus Ampicillin PMID:17920018 Backbone Marker:home made; Backbone Size:6000; Vector Backbone:Beta-actin/CMV-IRES-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:41 0
pMA2867
 
Resource Report
Resource Website
RRID:Addgene_25439 mCherry-miR155-lacZalpha Mus musculus Ampicillin PMID:19655272 Backbone Marker:unpublished; Backbone Size:6700; Vector Backbone:pMA2767; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:12:43 0
pEGFPm-DAD M1041A
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_25411 Diap3 Mus musculus Ampicillin PMID:11035012 The Q1091P mutation in the DAD region was not intentional and may have been a cloning error. Backbone Size:3000; Vector Backbone:EF-BOS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Alanine substitution at critical residue in DAD that is required for binding to the Dia-inhibitory domain (DID); the M1041A renders it biologically inactive. Q1091P mutation 2026-08-15 01:12:41 1
pCMV14/3xFLAG-Pax3
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_25427 Pax3 Mus musculus Ampicillin Backbone Marker:Sigma; Backbone Size:6310; Vector Backbone:p3XFLAG-CMV-14; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:41 1
pBabe-HA-mMcl-1(T144D)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_25388 mMCL1(T144D) Mus musculus Ampicillin PMID:19433446 Backbone Size:5169; Vector Backbone:pBabe IRES puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin P142T T144D 2026-08-15 01:12:41 1
YFP-mDia2
 
Resource Report
Resource Website
RRID:Addgene_25420 diap3 Mus musculus Kanamycin PMID:16361707 Backbone Marker:clontech Invitrogen; Backbone Size:3000; Vector Backbone:YFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Encodes mDia2 amino acids T47 to L1171 2026-08-15 01:12:41 0
pEN_hU6miR-Gb2-K
 
Resource Report
Resource Website
RRID:Addgene_25759 Gb2 miR-shRNA Mus musculus Gentamicin PMID:16945906 Entry vector with U6-driven G beta 2 miR-shRNA G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-08-15 01:12:47 0
pEN_hU6miR-G12-E
 
Resource Report
Resource Website
RRID:Addgene_25757 G alpha 12 miR-shRNA Mus musculus Gentamicin PMID:16945906 Entry vector with U6-driven G alpha 12 miR-shRNA G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT Addgene sequence shows that this plasmid is missing the EcoRI site. Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-08-15 01:12:45 0
Nampt-PET28a
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_25630 Nampt Mus musculus Kanamycin PMID:16783373 Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:PET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:12:44 1
pEN_TmiR_G13-L_G12-E
 
Resource Report
Resource Website
RRID:Addgene_25763 G alpha 13 and 12 miR-shRNA Mus musculus Gentamicin PMID:16945906 Entry vector with TRE-driven G alpha 12 and 13 miR-shRNA G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT There are 3 minor changes between depositor's sequence and Addgene's sequence - An extra T between the TRE promoter and first shRNA; a 17nt stretch between the shRNAs is different but will not affect function; and a single nt change mutates an EcoRI site just beyond the 2nd shRNA but will again not affect function. Backbone Marker:ATCC 10326362; Backbone Size:4641; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-08-15 01:12:45 0
pEN_TmiR_G13-L
 
Resource Report
Resource Website
RRID:Addgene_25762 G alpha 13 miR-shRNA Mus musculus Gentamicin PMID:16945906 Entry vector with TRE-driven G alpha 13 miR-shRNA G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT Addgene sequence shows that this plasmid is missing the SpeI site. Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-08-15 01:12:47 0
pEN_TmiR_Gb2-K
 
Resource Report
Resource Website
RRID:Addgene_25764 Gb2 miR-shRNA Mus musculus Gentamicin PMID:16945906 Entry vector with TRE-driven G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA Addgene sequence shows that this plasmid is missing the SpeI site. Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-08-15 01:12:45 0
pSLIK-Neo-TGmiR-Gb2
 
Resource Report
Resource Website
RRID:Addgene_25746 Gb2 Mus musculus Ampicillin PMID:16945906 Lentivirus; Inducible TRE driven GFP-shRNA (GB2); Constitutive Ubi-c driven rtTA3-IRES-Neo GB2 miR-shRNA: TGCTCATGTATTCCCACGACAA Backbone Marker:Iain Fraser; Backbone Size:13217; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:12:45 0
pSLIK-Venus-TmiR-G12
 
Resource Report
Resource Website
RRID:Addgene_25740 G alpha 12 miR-shRNA Mus musculus Ampicillin PMID:16945906 pSLIK-Venus with G alpha 12 miR-shRNA G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT Backbone Marker:Iain Fraser; Backbone Size:12370; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:12:45 0
pSLIK-Venus-TmiR-G13-G12
 
Resource Report
Resource Website
RRID:Addgene_25742 G alpha 13 and 12 miR-shRNA Mus musculus Ampicillin PMID:16945906 pSLIK-Venus with G alpha 12 and 13 miR-shRNA G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT There are 3 minor changes between depositor's sequence and Addgene's sequence - An extra T between the TRE promoter and first shRNA; a 17nt stretch between the shRNAs is different but will not affect function; and a single nt change mutates an EcoRI site just beyond the 2nd shRNA but will again not affect function. Backbone Marker:Iain Fraser; Backbone Size:12752; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:12:45 0
pGEX4T-1-mMcl-1
 
Resource Report
Resource Website
RRID:Addgene_25717 MCL1 Mus musculus Ampicillin PMID:19433446 Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:44 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.