Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pBabe-HA-mMcl-1(T144A) Resource Report Resource Website |
RRID:Addgene_25386 | mMCL1(T144A) | Mus musculus | Ampicillin | PMID:19433446 | Backbone Size:5169; Vector Backbone:pBabe IRES puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | changed threonine 144 to alanine | 2026-08-15 01:12:41 | 0 | |
|
pGEX4T-1-mMcl-1(S140A) Resource Report Resource Website |
RRID:Addgene_25381 | mMCL1(S140A) | Mus musculus | Ampicillin | PMID:19433446 | Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | changed serine 140 to alanine | 2026-08-15 01:12:43 | 0 | |
|
pEFmEGFP-mDia2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_25407 | mDia2 | Mus musculus | Ampicillin | PMID:10678165 | Backbone Marker:N/A; Backbone Size:3500; Vector Backbone:EF-BOS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Encodes mDia2 | 2026-08-15 01:12:41 | 4 | |
|
Let-7b-GFP Resource Report Resource Website |
RRID:Addgene_25404 | Mirlet7b | Mus musculus | Ampicillin | PMID:18957199 | The last nucleotide in the Letb insert is G rather than A but will not affect function. | Backbone Marker:University of Michigan Vector Core; Backbone Size:7650; Vector Backbone:pLentilox 3.7GFP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | None | 2026-08-15 01:12:41 | 0 |
|
HMGA2(3'UTR DEL)+GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_25406 | high mobility group AT-Hook 2 | Mus musculus | Ampicillin | PMID:18957199 | Please use the following link to view the backbone sequence: http://www2.med.umich.edu/medschool/vcore/PlasmidList.cfm | Backbone Marker:University of Michigan Vector Core; Backbone Size:7766; Vector Backbone:pLentilox RSV; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 3" UTR is absent | 2026-08-15 01:12:43 | 1 |
|
HMGA2+GFP Resource Report Resource Website |
RRID:Addgene_25405 | high mobility group AT-Hook 2 | Mus musculus | Ampicillin | PMID:18957199 | To view the backbone sequence please visit use the following link: http://www2.med.umich.edu/medschool/vcore/PlasmidList.cfm | Backbone Marker:University of Michigan Vector Core; Backbone Size:7766; Vector Backbone:pLentilox RSV; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | polyadenylation signal lacking | 2026-08-15 01:12:41 | 0 |
|
Actin-53b-ires-EGFP Resource Report Resource Website |
RRID:Addgene_25459 | BAF53b | Mus musculus | Ampicillin | PMID:17920018 | Backbone Marker:home made; Backbone Size:6000; Vector Backbone:Beta-actin/CMV-IRES-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:41 | 0 | ||
|
Actin-BAF53(b+a)-ires-EGFP Resource Report Resource Website |
RRID:Addgene_25462 | BAF53(b+a) | Mus musculus | Ampicillin | PMID:17920018 | Backbone Size:6000; Vector Backbone:Beta-actin/CMV-IRES-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 3' of mBAF53b deleted and fused to 3' of mBAF53a | 2026-08-15 01:12:41 | 0 | |
|
Actin-BAF53(a+b)-ires-EGFP Resource Report Resource Website |
RRID:Addgene_25461 | BAF53(a+b) | Mus musculus | Ampicillin | PMID:17920018 | Backbone Marker:home made; Backbone Size:6000; Vector Backbone:Beta-actin/CMV-IRES-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 3' of mBAF53a deleted and fused to 3' of mBAF53b | 2026-08-15 01:12:44 | 0 | |
|
Actin-53a-ires-EGFP Resource Report Resource Website |
RRID:Addgene_25460 | BAF53a | Mus musculus | Ampicillin | PMID:17920018 | Backbone Marker:home made; Backbone Size:6000; Vector Backbone:Beta-actin/CMV-IRES-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:41 | 0 | ||
|
pMA2867 Resource Report Resource Website |
RRID:Addgene_25439 | mCherry-miR155-lacZalpha | Mus musculus | Ampicillin | PMID:19655272 | Backbone Marker:unpublished; Backbone Size:6700; Vector Backbone:pMA2767; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:43 | 0 | ||
|
pEGFPm-DAD M1041A Resource Report Resource Website 1+ mentions |
RRID:Addgene_25411 | Diap3 | Mus musculus | Ampicillin | PMID:11035012 | The Q1091P mutation in the DAD region was not intentional and may have been a cloning error. | Backbone Size:3000; Vector Backbone:EF-BOS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Alanine substitution at critical residue in DAD that is required for binding to the Dia-inhibitory domain (DID); the M1041A renders it biologically inactive. Q1091P mutation | 2026-08-15 01:12:41 | 1 |
|
pCMV14/3xFLAG-Pax3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_25427 | Pax3 | Mus musculus | Ampicillin | Backbone Marker:Sigma; Backbone Size:6310; Vector Backbone:p3XFLAG-CMV-14; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:41 | 1 | |||
|
pBabe-HA-mMcl-1(T144D) Resource Report Resource Website 1+ mentions |
RRID:Addgene_25388 | mMCL1(T144D) | Mus musculus | Ampicillin | PMID:19433446 | Backbone Size:5169; Vector Backbone:pBabe IRES puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | P142T T144D | 2026-08-15 01:12:41 | 1 | |
|
YFP-mDia2 Resource Report Resource Website |
RRID:Addgene_25420 | diap3 | Mus musculus | Kanamycin | PMID:16361707 | Backbone Marker:clontech Invitrogen; Backbone Size:3000; Vector Backbone:YFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Encodes mDia2 amino acids T47 to L1171 | 2026-08-15 01:12:41 | 0 | |
|
pEN_hU6miR-Gb2-K Resource Report Resource Website |
RRID:Addgene_25759 | Gb2 miR-shRNA | Mus musculus | Gentamicin | PMID:16945906 | Entry vector with U6-driven G beta 2 miR-shRNA G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA | Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | 2026-08-15 01:12:47 | 0 | |
|
pEN_hU6miR-G12-E Resource Report Resource Website |
RRID:Addgene_25757 | G alpha 12 miR-shRNA | Mus musculus | Gentamicin | PMID:16945906 | Entry vector with U6-driven G alpha 12 miR-shRNA G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT Addgene sequence shows that this plasmid is missing the EcoRI site. | Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | 2026-08-15 01:12:45 | 0 | |
|
Nampt-PET28a Resource Report Resource Website 1+ mentions |
RRID:Addgene_25630 | Nampt | Mus musculus | Kanamycin | PMID:16783373 | Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:PET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:44 | 1 | ||
|
pEN_TmiR_G13-L_G12-E Resource Report Resource Website |
RRID:Addgene_25763 | G alpha 13 and 12 miR-shRNA | Mus musculus | Gentamicin | PMID:16945906 | Entry vector with TRE-driven G alpha 12 and 13 miR-shRNA G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT There are 3 minor changes between depositor's sequence and Addgene's sequence - An extra T between the TRE promoter and first shRNA; a 17nt stretch between the shRNAs is different but will not affect function; and a single nt change mutates an EcoRI site just beyond the 2nd shRNA but will again not affect function. | Backbone Marker:ATCC 10326362; Backbone Size:4641; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | 2026-08-15 01:12:45 | 0 | |
|
pEN_TmiR_G13-L Resource Report Resource Website |
RRID:Addgene_25762 | G alpha 13 miR-shRNA | Mus musculus | Gentamicin | PMID:16945906 | Entry vector with TRE-driven G alpha 13 miR-shRNA G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT Addgene sequence shows that this plasmid is missing the SpeI site. | Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | 2026-08-15 01:12:47 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.