Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: pADH1 PP7∆FG-mCherry tCYC1
Vector Backbone Description: Backbone Size:3861; Vector Backbone:pSIVURA; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32576833
Proper citation: RRID:Addgene_139496 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: pADH1 MS2-GFPenvy tCYC1
Vector Backbone Description: Backbone Size:3861; Vector Backbone:pSIVURA; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32576833
Proper citation: RRID:Addgene_139497 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: pGPD Cas9 / sgRNA (STL162)
Vector Backbone Description: Backbone Size:5726; Vector Backbone:pRS423II; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32576833
Proper citation: RRID:Addgene_139498 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: pSTL1 24xPP7sl STL1 100 - 600
Vector Backbone Description: Backbone Size:3950; Vector Backbone:pHIS; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32576833
Proper citation: RRID:Addgene_139499 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: ABKAR(T/A)
Vector Backbone Description: Backbone Size:5517; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25788287
Proper citation: RRID:Addgene_140052 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: ABKAR
Vector Backbone Description: Backbone Size:5517; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25788287
Proper citation: RRID:Addgene_140051 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: MUP1
Vector Backbone Description: Vector Backbone:YIplac211; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32584255
Comments: Parental strain JK93da.
Proper citation: RRID:Addgene_140152 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: NDT1 with 5' and 3' UTRs
Vector Backbone Description: Vector Backbone:YCplac33C; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33087354
Proper citation: RRID:Addgene_140593 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Flpe
Vector Backbone Description: Backbone Size:4779; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17209010
Comments: Kozak consensus sequence was added before the start ATG. Internal EcoRI site was destroyed by introducing a silent mutation. Myc-tag was added at the C-terminus of Flpe.
Proper citation: RRID:Addgene_13787 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Flpe-GFP fusion protein
Vector Backbone Description: Backbone Size:4779; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression, Flp/FRT; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17209010
Comments: Kozak consensus sequence was added before the start ATG. Internal EcoRI site was destroyed by introducing a silent mutation.
Proper citation: RRID:Addgene_13788 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: NPL3
Vector Backbone Description: Backbone Size:6018; Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9499403
Comments: 3.5kb ScaI fragment ligated into SmaI digested vector (CEN plasmid). See author's map.
Proper citation: RRID:Addgene_1379 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Cerulean-FHA1-NES
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5472; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21438554
Proper citation: RRID:Addgene_138202 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RLuc8C-FHA1-NES
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5472; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21438554
Proper citation: RRID:Addgene_138210 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: lox-mCherry-lox-Booster-PKA
Vector Backbone Description: Backbone Size:6500; Vector Backbone:pT2ADW; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32101394
Comments: Depositor found that the linker region of the Booster-PKA insert may be 42 bp longer than shown in their reference sequence, but that the plasmid functions as reported in the associated publication.
Sequences are based on next-generation sequencing (NGS) results where indicated (Addgene NGS Result), or assembled from reference sequences and/or Sanger results (Addgene Assembled Sequence). Sequence provided by depositing laboratory may be theoretical/predicted or based on Sanger/NGS sequencing results. Discrepancies between sequencing results obtained by Addgene and the original sequence provided by the depositor may be present.
Proper citation: RRID:Addgene_138374 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Booster-JNK
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32101394
Comments: Sequences are based on next-generation sequencing (NGS) results where indicated (Addgene NGS Result), or assembled from reference sequences and/or Sanger results (Addgene Assembled Sequence). Sequence provided by depositing laboratory may be theoretical/predicted or based on Sanger/NGS sequencing results. Discrepancies between sequencing results obtained by Addgene and the original sequence provided by the depositor may be present.
Proper citation: RRID:Addgene_138376 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: GAL4
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_138621 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: 4xCDRE-CYC1(PM)-yEGFP3-PEST
Vector Backbone Description: Vector Backbone:pAMS366; Vector Types:yeast reporter plasmid; Bacterial Resistance:Ampicillin
Comments: 1x CDRE (calcineurin-dependent response element) = caagcgcacagccaccgactggtg
For construction of pAMS366-4xCDRE-GFP-PEST, we used yEGFP3-PEST from
Mateus & Avery 2000 (original yEGFP3 from Cormack et al. 1997),
sequencing showed a 216T>G silent mutation.
Proper citation: RRID:Addgene_138658 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: 4xCDRE-CYC1(PM)-yeGFP
Vector Backbone Description: Vector Backbone:pAMS366; Vector Types:yeast reporter plasmid; Bacterial Resistance:Ampicillin
Comments: 1x CDRE (calcineurin-dependent response element) = caagcgcacagccaccgactggtg
For construction of pAMS366-4xCDRE-GFP, we used yeGFP from pYM25 (Janke
et al. 2004, sequence available from euroscarf), sequencing showed a
644C>G (Thr>Arg) mutation."
Proper citation: RRID:Addgene_138657 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: ura3 gene
Vector Backbone Description: Backbone Marker:Sigma-Aldrich; Backbone Size:7675; Vector Backbone:pACD4K-C; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31419111
Proper citation: RRID:Addgene_138711 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: GCR1
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_138618 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
