Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Gb2 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA
Addgene sequence shows that this plasmid is missing the SpeI site.
Proper citation: RRID:Addgene_25764 Copy
Species: Mus musculus
Genetic Insert: Gb2
Vector Backbone Description: Backbone Marker:Iain Fraser; Backbone Size:13217; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16945906
Comments: Lentivirus; Inducible TRE driven GFP-shRNA (GB2); Constitutive Ubi-c driven rtTA3-IRES-Neo
GB2 miR-shRNA: TGCTCATGTATTCCCACGACAA
Proper citation: RRID:Addgene_25746 Copy
Species: Mus musculus
Genetic Insert: G alpha 12 miR-shRNA
Vector Backbone Description: Backbone Marker:Iain Fraser; Backbone Size:12370; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16945906
Comments: pSLIK-Venus with G alpha 12 miR-shRNA
G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT
Proper citation: RRID:Addgene_25740 Copy
Species: Mus musculus
Genetic Insert: G alpha 13 and 12 miR-shRNA
Vector Backbone Description: Backbone Marker:Iain Fraser; Backbone Size:12752; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16945906
Comments: pSLIK-Venus with G alpha 12 and 13 miR-shRNA
G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT
G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT
There are 3 minor changes between depositor's sequence and Addgene's sequence - An extra T between the TRE promoter and first shRNA; a 17nt stretch between the shRNAs is different but will not affect function; and a single nt change mutates an EcoRI site just beyond the 2nd shRNA but will again not affect function.
Proper citation: RRID:Addgene_25742 Copy
Species: Mus musculus
Genetic Insert: MCL1
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19433446
Proper citation: RRID:Addgene_25717 Copy
Species: Mus musculus
Genetic Insert: Ig germline mu switch region
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:4361; Vector Backbone:pBR322; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:6278424
Comments: Includes a 5 kb EcoRI/BamHI fragment with Smu (3 kb deletion relative to the germline) and both 5' and 3' flanking sequences.
Proper citation: RRID:Addgene_25912 Copy
Species: Mus musculus
Genetic Insert: Ig germline gamma-1 switch region alpha
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:4361; Vector Backbone:pBR322; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:6292864
Comments: Includes a 5 kb fragment germline, which includes most of the Calpha switch region (Salpha) and part of Calpha.
NB: CH switch (S) regions
Proper citation: RRID:Addgene_25911 Copy
Species: Mus musculus
Genetic Insert: FSP27
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6100; Vector Backbone:pLNCX2; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_25880 Copy
Species: Mus musculus
Genetic Insert: Brahma related gene 1
Vector Backbone Description: Backbone Marker:Toshio Kitamura; Backbone Size:4628; Vector Backbone:pMX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20550931
Proper citation: RRID:Addgene_25855 Copy
Species: Mus musculus
Genetic Insert: Brg1 associated factor 155
Vector Backbone Description: Backbone Size:4628; Vector Backbone:pMX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20550931
Proper citation: RRID:Addgene_25856 Copy
Species: Mus musculus
Genetic Insert: p21
Vector Backbone Description: Backbone Marker:Ivanova, NB; Backbone Size:10130; Vector Backbone:FUGW-H1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18371338
Comments: This plasmid targets the open reading frame of p21. The 19mer target sequence is: TTAGGACTCAACCGTAATA
Proper citation: RRID:Addgene_25868 Copy
Species: Mus musculus
Genetic Insert: loxP-Oct4-P2A-Sox2-T2A-Klf4-E2A-cMyc-loxP
Vector Backbone Description: Backbone Size:10600; Vector Backbone:mCol.loxneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20010831
Proper citation: RRID:Addgene_25795 Copy
Species: Mus musculus
Genetic Insert: Goosecoid
Vector Backbone Description: Backbone Size:4095; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: antisense: linearize with Sac1, transcribe with T3
sense: linearize with HindIII, transcribe with T7
Proper citation: RRID:Addgene_25777 Copy
Species: Mus musculus
Genetic Insert: RapR-Src
Vector Backbone Description: Backbone Size:5700; Vector Backbone:pUSE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20581846
Proper citation: RRID:Addgene_25934 Copy
Species: Mus musculus
Genetic Insert: RapR-Src
Vector Backbone Description: Backbone Size:5700; Vector Backbone:pUSE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20581846
Proper citation: RRID:Addgene_25933 Copy
Species: Mus musculus
Genetic Insert: twisted gastrulation
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3016; Vector Backbone:pGEM-T Easy; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Best in situ probe.
Antisense cut with XhoI, transcribe with SP6
Proper citation: RRID:Addgene_25780 Copy
Species: Mus musculus
Genetic Insert: MyoD
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4775; Vector Backbone:pFastBac1; Vector Types:Baculovirus Transfer Vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15289617
Proper citation: RRID:Addgene_25994 Copy
Species: Mus musculus
Genetic Insert: Drp1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1(-)Myc/His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12527753
Comments: Though this vector backbone has Myc and His tags, they are not in frame with the Drp1. Do not use these tags for purification or detection after expression.
Proper citation: RRID:Addgene_26049 Copy
Species: Mus musculus
Genetic Insert: Kinase suppressor of Ras 1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11741955
Proper citation: RRID:Addgene_25976 Copy
Species: Mus musculus
Genetic Insert: Kinase suppressor of Ras 1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11741955
Proper citation: RRID:Addgene_25975 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
