Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pEN_TmiR_Gb2-K Resource Report Resource Website |
RRID:Addgene_25764 | Gb2 miR-shRNA | Mus musculus | Gentamicin | PMID:16945906 | Entry vector with TRE-driven G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA Addgene sequence shows that this plasmid is missing the SpeI site. | Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | 2026-08-15 01:12:45 | 0 | |
|
pSLIK-Neo-TGmiR-Gb2 Resource Report Resource Website |
RRID:Addgene_25746 | Gb2 | Mus musculus | Ampicillin | PMID:16945906 | Lentivirus; Inducible TRE driven GFP-shRNA (GB2); Constitutive Ubi-c driven rtTA3-IRES-Neo GB2 miR-shRNA: TGCTCATGTATTCCCACGACAA | Backbone Marker:Iain Fraser; Backbone Size:13217; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:45 | 0 | |
|
pSLIK-Venus-TmiR-G12 Resource Report Resource Website |
RRID:Addgene_25740 | G alpha 12 miR-shRNA | Mus musculus | Ampicillin | PMID:16945906 | pSLIK-Venus with G alpha 12 miR-shRNA G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT | Backbone Marker:Iain Fraser; Backbone Size:12370; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:45 | 0 | |
|
pSLIK-Venus-TmiR-G13-G12 Resource Report Resource Website |
RRID:Addgene_25742 | G alpha 13 and 12 miR-shRNA | Mus musculus | Ampicillin | PMID:16945906 | pSLIK-Venus with G alpha 12 and 13 miR-shRNA G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT There are 3 minor changes between depositor's sequence and Addgene's sequence - An extra T between the TRE promoter and first shRNA; a 17nt stretch between the shRNAs is different but will not affect function; and a single nt change mutates an EcoRI site just beyond the 2nd shRNA but will again not affect function. | Backbone Marker:Iain Fraser; Backbone Size:12752; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:45 | 0 | |
|
pGEX4T-1-mMcl-1 Resource Report Resource Website |
RRID:Addgene_25717 | MCL1 | Mus musculus | Ampicillin | PMID:19433446 | Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:44 | 0 | ||
|
PJ14 Resource Report Resource Website 1+ mentions |
RRID:Addgene_25912 | Ig germline mu switch region | Mus musculus | Ampicillin | PMID:6278424 | Includes a 5 kb EcoRI/BamHI fragment with Smu (3 kb deletion relative to the germline) and both 5' and 3' flanking sequences. | Backbone Marker:ATCC; Backbone Size:4361; Vector Backbone:pBR322; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:46 | 1 | |
|
p64-101 Resource Report Resource Website |
RRID:Addgene_25911 | Ig germline gamma-1 switch region alpha | Mus musculus | Ampicillin | PMID:6292864 | Includes a 5 kb fragment germline, which includes most of the Calpha switch region (Salpha) and part of Calpha. NB: CH switch (S) regions | Backbone Marker:ATCC; Backbone Size:4361; Vector Backbone:pBR322; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:49 | 0 | |
|
(O75) FSP27/pLNCX2 Resource Report Resource Website |
RRID:Addgene_25880 | FSP27 | Mus musculus | Ampicillin | Backbone Marker:Clontech; Backbone Size:6100; Vector Backbone:pLNCX2; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:46 | 0 | |||
|
pMX-Brg1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_25855 | Brahma related gene 1 | Mus musculus | Ampicillin | PMID:20550931 | Backbone Marker:Toshio Kitamura; Backbone Size:4628; Vector Backbone:pMX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:45 | 2 | ||
|
pMX-Baf155 Resource Report Resource Website 1+ mentions |
RRID:Addgene_25856 | Brg1 associated factor 155 | Mus musculus | Ampicillin | PMID:20550931 | Backbone Size:4628; Vector Backbone:pMX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:48 | 1 | ||
|
p21 shRNA1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_25868 | p21 | Mus musculus | Ampicillin | PMID:18371338 | This plasmid targets the open reading frame of p21. The 19mer target sequence is: TTAGGACTCAACCGTAATA | Backbone Marker:Ivanova, NB; Backbone Size:10130; Vector Backbone:FUGW-H1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:46 | 3 | |
|
mCol.2lox4F2A targeting construct Resource Report Resource Website |
RRID:Addgene_25795 | loxP-Oct4-P2A-Sox2-T2A-Klf4-E2A-cMyc-loxP | Mus musculus | Ampicillin | PMID:20010831 | Backbone Size:10600; Vector Backbone:mCol.loxneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:48 | 0 | ||
|
mGoosecoid Resource Report Resource Website |
RRID:Addgene_25777 | Goosecoid | Mus musculus | Ampicillin | antisense: linearize with Sac1, transcribe with T3 sense: linearize with HindIII, transcribe with T7 | Backbone Size:4095; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:45 | 0 | ||
|
pUSE-RapR-Src(KD)-myc Resource Report Resource Website 1+ mentions |
RRID:Addgene_25934 | RapR-Src | Mus musculus | Ampicillin | PMID:20581846 | Backbone Size:5700; Vector Backbone:pUSE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | This pUSE-RapR-Src(KD)-myc plasmid contains the kinase inactive mutation D388R. The uploaded sequence data is based on wt. | 2026-08-15 01:12:46 | 1 | |
|
pUSE-RapR-Src-myc Resource Report Resource Website 1+ mentions |
RRID:Addgene_25933 | RapR-Src | Mus musculus | Ampicillin | PMID:20581846 | Backbone Size:5700; Vector Backbone:pUSE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:49 | 5 | ||
|
pGEM mouse twisted gastrulation Resource Report Resource Website |
RRID:Addgene_25780 | twisted gastrulation | Mus musculus | Ampicillin | Best in situ probe. Antisense cut with XhoI, transcribe with SP6 | Backbone Marker:Promega; Backbone Size:3016; Vector Backbone:pGEM-T Easy; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:48 | 0 | ||
|
pFB-Flag-MyoD Resource Report Resource Website |
RRID:Addgene_25994 | MyoD | Mus musculus | Ampicillin | PMID:15289617 | Backbone Marker:Invitrogen; Backbone Size:4775; Vector Backbone:pFastBac1; Vector Types:Baculovirus Transfer Vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:50 | 0 | ||
|
mouse Drp1(K38A) Resource Report Resource Website 1+ mentions |
RRID:Addgene_26049 | Drp1 | Mus musculus | Ampicillin | PMID:12527753 | Though this vector backbone has Myc and His tags, they are not in frame with the Drp1. Do not use these tags for purification or detection after expression. | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1(-)Myc/His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | K38A GTPase mutant | 2026-08-15 01:12:47 | 7 |
|
pCMV5 KSR1 S392A Resource Report Resource Website |
RRID:Addgene_25976 | Kinase suppressor of Ras 1 | Mus musculus | Ampicillin | PMID:11741955 | Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | changed serine 392 to alanine | 2026-08-15 01:12:47 | 0 | |
|
pCMV5 KSR1 T274V Resource Report Resource Website |
RRID:Addgene_25975 | Kinase suppressor of Ras 1 | Mus musculus | Ampicillin | PMID:11741955 | Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | changed threonine 274 to valine | 2026-08-15 01:12:47 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
