Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pCDH-F-PA1 Resource Report Resource Website |
RRID:Addgene_40618 | PA1 | Homo sapiens | Ampicillin | PMID:22949634 | Backbone Marker:System Biosciences (SBI); Backbone Size:8295; Vector Backbone:pCDH-EF1-MCS-IRES-Neo; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:37 | 0 | ||
|
RPRD1B Resource Report Resource Website |
RRID:Addgene_40739 | RPRD1B | Homo sapiens | Ampicillin | http://www.thesgc.org/structures/4FLA/ | Backbone Marker:SGC; Vector Backbone:pET15-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:38 | 0 | ||
|
pTH731-2µ-RLuc/minCFLuc Resource Report Resource Website 1+ mentions |
RRID:Addgene_40601 | Firefly Luciferase | Photinus pyralis | Ampicillin | PMID:24357599 | Backbone Marker:Miller et al (1998) Nucleic Acids Res 26(15):3577-3583 ; Backbone Size:6518; Vector Backbone:pBEVY-U; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | All codons of the original FLuc gene were exchanged for those isoaccepting codons decoded by the least abundant tRNAs in yeast. The last three codons of the full-length Firefly luciferase gene have been deleted to yield a luciferase variant which is fully functional, but no longer localises to peroxisomes. | 2026-08-15 01:14:37 | 1 | |
|
pEMB018 LRRK2_BC_1520_2148_K1906M Resource Report Resource Website |
RRID:Addgene_40567 | LRRK2 | Homo sapiens | Ampicillin | Backbone Marker:Emerald; Vector Backbone:pEMB108; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin | aa1520_2148; K1906M | 2026-08-15 01:14:37 | 0 | ||
|
pTH646-2µ-RLuc Resource Report Resource Website 1+ mentions |
RRID:Addgene_40600 | Renilla Luciferase | Saccharomyces cerevisiae | Ampicillin | PMID:24357599 | Backbone Marker:Miller et al (1998) Nucleic Acids Res 26(15):3577-3583 ; Backbone Size:6518; Vector Backbone:pBEVY-U; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:37 | 1 | ||
|
pEMB52 LRRK2_BC_1520_2210_I2211ENLYFQGWSHPQFEK Resource Report Resource Website |
RRID:Addgene_40565 | LRRK2 | Homo sapiens | Ampicillin | Backbone Marker:Emerald; Vector Backbone:pEMB52; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin | WT; aa1520_2210 | 2026-08-15 01:14:37 | 0 | ||
|
pEMB12 LRRK2_BC_1847_2210_K1906M Resource Report Resource Website |
RRID:Addgene_40564 | LRRK2 | Homo sapiens | Ampicillin | Backbone Marker:Emerald; Vector Backbone:pEMB12; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin | aa1847_2210; K1906M | 2026-08-15 01:14:37 | 0 | ||
|
pEMB36(revcomp)/Dvl1_1_670 Resource Report Resource Website |
RRID:Addgene_40557 | DVL1 | Homo sapiens | Ampicillin | The insert has been codon optimized. | Backbone Marker:Emerald; Vector Backbone:pEMB36; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin | WT; aa1_670 | 2026-08-15 01:14:37 | 0 | |
|
pEMB44 / Mouse_LRRK2_1_342 Resource Report Resource Website |
RRID:Addgene_40555 | Lrrk2 | Mus musculus | Ampicillin | Backbone Marker:Emerald; Vector Backbone:pEMB44; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin | WT | 2026-08-15 01:14:37 | 0 | ||
|
pEMB12 / LRRK2_BC_1847_2210 Resource Report Resource Website |
RRID:Addgene_40553 | LRRK2 | Homo sapiens | Ampicillin | Backbone Marker:Emerald; Vector Backbone:pEMB12; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin | WT; aa1847_2210 | 2026-08-15 01:14:37 | 0 | ||
|
pEMB52/Horse_34_374 Resource Report Resource Website |
RRID:Addgene_40544 | LRRK2 | Equus caballus | Ampicillin | Backbone Marker:Emerald; Vector Backbone:pEMB52; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin | WT | 2026-08-15 01:14:37 | 0 | ||
|
pEMB52/Armadillo_34_373 Resource Report Resource Website |
RRID:Addgene_40543 | LRRK2 | Dasypus novemcinctus | Ampicillin | Backbone Marker:Emerald; Vector Backbone:pEMB52; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin | WT | 2026-08-15 01:14:37 | 0 | ||
|
pEMB52/Dvl1_1_670 Resource Report Resource Website |
RRID:Addgene_40542 | DVL1 | Homo sapiens | Ampicillin | Backbone Marker:Emerald; Vector Backbone:pEMB52; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin | WT | 2026-08-15 01:14:37 | 0 | ||
|
pEMB52/14-3-3_1_247 Resource Report Resource Website 1+ mentions |
RRID:Addgene_40541 | YWHAG | Homo sapiens | Ampicillin | Backbone Marker:Emerald; Vector Backbone:pEMB52; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin | WT; aa1-247 | 2026-08-15 01:14:37 | 1 | ||
|
phage-cmv-cfp-24xpp7 Resource Report Resource Website 1+ mentions |
RRID:Addgene_40652 | CFP-24xPP7 | Synthetic | Ampicillin | PMID:22735544 | Please note that the final PP7 stem loop ends with CCAGCAGAGCATATGGGCTCG The depositing laboratory confirmed that the plasmid functions as described in the associated publication. The sequence for a single cassette (with the two non-identical stem-loops in uppercase) is: taaggtacctaattgcctagaaaGGAGCAGACGATATGGCGTCGCTCCctgcaggtcgactctagaaa- CCAGCAGAGCATATGGGCTCGCTGGctgcagtattcccgggttcatt | Vector Backbone:pHAGE-CMV; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:38 | 5 | |
|
phage-cmv-cfp-24xms2 Resource Report Resource Website 10+ mentions |
RRID:Addgene_40651 | CFP-24xMBS | Synthetic | Ampicillin | PMID:22735544 | The Singer Lab no longer recommends this plasmid, as it has a higher rate of bacterial recombination. For mammalian cells they recommend the following plasmids: pUbC-FLAG-24xSuntagV4-oxEBFP-AID-baUTR1-24xMS2V5-Wpre (Plasmid #84561) HaloTag-bActinCDS-bActinUTR-MS2V5 (Plasmid #102718) For yeast cells they recommend the following plasmids: pET246-pUC57 12xMS2V6 (Plasmid #104390) pET259-pUC57 24xMS2V6 (Plasmid #104391) pET251-pUC 12xMS2V6 Loxp KANr Loxp (Plasmid #104392) pET264-pUC 24xMS2V6 Loxp KANr Loxp (Plasmid #104393) Due to the propensity of the plasmid to recombine, Addgene recommends screening multiple colonies by restriction analysis to ensure that the isolated clones contain a full set of 24 MS2 repeats | Vector Backbone:pHAGE-CMV; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:38 | 11 | |
|
phage-ubc-nls-ha-tdPCP-gfp Resource Report Resource Website 1+ mentions |
RRID:Addgene_40650 | tdPCP-gfp | Synthetic | Ampicillin | PMID:22735544 | The linker region between the two PCPs is CGTGCGGATCCGCTAGCCTCC | Vector Backbone:pHAGE-UBC-RIG (modified); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:38 | 9 | |
|
phage-ubc-nls-ha-tdMCP-gfp Resource Report Resource Website 10+ mentions |
RRID:Addgene_40649 | tdMCP-gfp | Synthetic | Ampicillin | PMID:22735544 | The linker region between the two MCPs is ATCTACGCCATGGCTTCT | Vector Backbone:pHAGE-UBC-RIG (modified); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:38 | 21 | |
|
pLKO.1-sh-hSOX9-1 Resource Report Resource Website 10+ mentions |
RRID:Addgene_40644 | sh-hSOX9-1 | Homo sapiens | Ampicillin | PMID:22385965 | Backbone Marker:Weinberg lab; Backbone Size:7032; Vector Backbone:pLKO.1 puro (Addgene plasmid 8453); Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:38 | 11 | ||
|
mutpRL-TK 4xUTR Resource Report Resource Website |
RRID:Addgene_40759 | 4 copies of the CXCR4 small RNA target site | Ampicillin | PMID:21878547 | Backbone Marker:Sharp Lab (http://web.mit.edu/sharplab/RNAi/Cloning.html); Vector Backbone:mutpRL-TK; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | mutated from TAG to CTC at nt 387–389 of the Renilla luciferase open reading frame to generate mismatches with seed positions 5, 6, and 7 of the siRNA guide strand by PCR-directed mutagenesis | 2026-08-15 01:14:38 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
