Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: G alpha 13 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven G alpha 13 miR-shRNA
G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT
Addgene sequence shows that this plasmid is missing the SpeI site.
Proper citation: RRID:Addgene_25762 Copy
Genetic Insert: Luciferase miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4990; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven luciferase miR-shRNA and co-expressed GFP
Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCC ACAGATGTATTAATCAGAGACTTCAGGCGGT
Proper citation: RRID:Addgene_25765 Copy
Species: Mus musculus
Genetic Insert: Gb2 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA
Addgene sequence shows that this plasmid is missing the SpeI site.
Proper citation: RRID:Addgene_25764 Copy
Genetic Insert: Luciferase miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven luciferase miR-shRNA
Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCC ACAGATGTATTAATCAGAGACTTCAGGCGGT
Proper citation: RRID:Addgene_25760 Copy
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:5303; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; TRE Pmin promoter + GFP spacer; Entry vector backbone; +ccdB in parent; Multiple unique sites d/s of TRE
Proper citation: RRID:Addgene_25749 Copy
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4608; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; TRE Pmin promoter; Entry vector backbone; +ccdB in parent; Multiple unique sites d/s of TRE
Proper citation: RRID:Addgene_25748 Copy
Genetic Insert: rfp
Vector Backbone Description: Vector Backbone:pRIM2; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Gentamicin
Defining Citation: PMID:26829286
Proper citation: RRID:Addgene_74073 Copy
Species: Synthetic
Genetic Insert: aacC1
Vector Backbone Description: Backbone Marker:Alexeyev, M.F., BioTechniques 18:52-54, 1995; Vector Backbone:pBSL15; Vector Types:Bacterial vector based on pMB1 replicon; Bacterial Resistance:Gentamicin
Defining Citation: PMID:26921431
Proper citation: RRID:Addgene_74106 Copy
Vector Backbone Description: Vector Backbone:pUC18; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:26341612
Comments: See J. Microbio. Methods 2015 118:75-79 for details
The authors used this vector along with a Tn7 transposase encoding plasmid, pTNS1.
Proper citation: RRID:Addgene_70115 Copy
Species: Homo sapiens
Genetic Insert: GATA Binding Protein 6
Vector Backbone Description: Backbone Marker:Addgene#25752; Backbone Size:4422; Vector Backbone:pEN_TTmiRC2; Vector Types:Bacterial Expression, Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:27273097
Proper citation: RRID:Addgene_72922 Copy
Vector Backbone Description: Vector Backbone:pUC18T-mini-Tn7T-oriT; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:15908923
Proper citation: RRID:Addgene_63121 Copy
Species: Mus musculus
Genetic Insert: BICD2N (1-400)
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pOmniBac; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:24986880
Proper citation: RRID:Addgene_64070 Copy
Vector Backbone Description: Backbone Size:57000; Vector Backbone:pTA-Mob 2.0; Vector Types:Bacterial Expression, Yeast Expression, Synthetic Biology; Bacterial Resistance:Gentamicin
Defining Citation: PMID:37850145
Proper citation: RRID:Addgene_188617 Copy
Species: Hemophilus influenzae
Genetic Insert: HindII
Vector Backbone Description: Backbone Size:57000; Vector Backbone:pTA-Mob 2.0; Vector Types:Bacterial Expression, Yeast Expression, Synthetic Biology, Diatom Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:37850145
Proper citation: RRID:Addgene_188625 Copy
Vector Backbone Description: Backbone Size:57000; Vector Backbone:pTA-Mob 2.0; Vector Types:Bacterial Expression, Yeast Expression, Synthetic Biology, Diatom Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:37850145
Proper citation: RRID:Addgene_194645 Copy
Species: Scytonema hofmannii
Genetic Insert: ShTnsB, ShTnsC, ShTniQ, ShCas12k
Vector Backbone Description: Backbone Size:3359; Vector Backbone:pR01600; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin
Defining Citation: PMID:37368499
Comments: The vector backbone was derived from plasmid pFlpe2 from
Choi, K. H., Mima, T., Casart, Y., Rholl, D., Kumar, A., Beacham, I. R., & Schweizer, H. P. (2008). Genetic tools for select-agent-compliant manipulation of Burkholderia pseudomallei. Applied and environmental microbiology, 74(4), 1064–1075. https://doi.org/10.1128/AEM.02430-07
Proper citation: RRID:Addgene_180076 Copy
Species: Synthetic
Genetic Insert: mScarlet counter-selection cassette
Vector Backbone Description: Backbone Size:2545; Vector Backbone:BASIC_SEVA_69.11; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin
Defining Citation: PMID:36381610
Proper citation: RRID:Addgene_194214 Copy
Vector Backbone Description: Backbone Size:57000; Vector Backbone:pTA-Mob 2.0; Vector Types:Bacterial Expression, Yeast Expression, Synthetic Biology, Diatom Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:37850145
Proper citation: RRID:Addgene_188609 Copy
Vector Backbone Description: Backbone Size:5700; Vector Backbone:pTA-Mob 2.0; Vector Types:Bacterial Expression, Yeast Expression, Synthetic Biology; Bacterial Resistance:Gentamicin
Defining Citation: PMID:37850145
Proper citation: RRID:Addgene_188610 Copy
Species: Homo sapiens
Genetic Insert: XRCC6
Vector Backbone Description: Backbone Marker:Addgene #25752; Vector Backbone:pEN_TTmiRC2-3xFLAG; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:37055441
Proper citation: RRID:Addgene_192302 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
