Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Drosophila melanogaster
Genetic Insert: SIK3
Vector Backbone Description: Backbone Size:8904; Vector Backbone:pUAST; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21565616
Proper citation: RRID:Addgene_52976 Copy
Species: E.coli
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23878244
Comments: The PconNoHindM12 promoter is the same as PconNoHind except for two substitution mutations at the −10 and −35 sites that moderately decrease transcription.
Proper citation: RRID:Addgene_53036 Copy
Species: Homo sapiens
Genetic Insert: Potassium voltage-gated channel subfamily H member 2
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3017; Vector Backbone:pSP64; Vector Types:Xenopus Oocyte Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11005845
Proper citation: RRID:Addgene_53051 Copy
Species: Homo sapiens
Genetic Insert: Potassium voltage-gated channel subfamily E member 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:10185; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8900283
Proper citation: RRID:Addgene_53050 Copy
Species: Homo sapiens
Genetic Insert: Potassium voltage-gated channel subfamily H member 2
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3017; Vector Backbone:pSP64; Vector Types:Xenopus Oocyte Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11005845
Proper citation: RRID:Addgene_53055 Copy
Species: Homo sapiens
Genetic Insert: Potassium voltage-gated channel subfamily H member 2
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3017; Vector Backbone:pSP64; Vector Types:Xenopus Oocyte Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11005845
Proper citation: RRID:Addgene_53054 Copy
Species: wheat
Genetic Insert: wheat U6 promoter - gRNA
Vector Backbone Description: Backbone Marker:CWBIO; Backbone Size:2700; Vector Backbone:pUC-T; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23929338
Proper citation: RRID:Addgene_53062 Copy
Species: Streptococcus pyogenes
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:pGREEN; Backbone Size:3741; Vector Backbone:pJIT163; Vector Types:Plant expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23929338
Proper citation: RRID:Addgene_53064 Copy
Vector Backbone Description: Backbone Marker:JBEI; Backbone Size:8000; Vector Backbone:pBullet; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24905498
Comments: See http://gt.jbei.org/ for more information on the JBEI glycosyltransferase collection.
Proper citation: RRID:Addgene_53065 Copy
Species: Hepatitis B virus
Genetic Insert: HBSP
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6360; Vector Backbone:pBIND; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24758376
Proper citation: RRID:Addgene_53113 Copy
Species: Thermus thermophilus
Genetic Insert: TtAgo
Vector Backbone Description: Backbone Marker:EMD Millipore; Backbone Size:3621; Vector Backbone:pCDF-1b; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:24531762
Proper citation: RRID:Addgene_53082 Copy
Species: Homo sapiens
Genetic Insert: Gfa2
Vector Backbone Description: Vector Backbone:pUC18; Vector Types:Mammalian Expression, Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8120611
Comments: The plasmid is a pUC18 vector containing the human GFAP sequences from -2163 to +47 (the human gfa2 segment), with the initiating ATG mutated to TTG, placed in front of the nuclear targeted E. coli lacZ gene, which in turn is followed by a fragment of the mouse protamine-1 gene. The latter supplies an intron, stabilizing 3' UTR, and a polyadenylation signal. If cloning a cDNA, it is advisable to retain the mP-1 segment. The lacZ gene can be excised by digestion with BamHI, and replaced with your gene of interest. If cloning a genomic sequence that includes an intron and polyadenylation site (this may compromise astrocyte specificity--see Su et al. 2004), the mP-1 region can also be excised, or alternatively, a number of sites flank the gfa2 segment allowing its isolation.
Restriction sites that may be useful are as follows:
EcoRI: flanks the gfa2, lacZ, and mP-1 segments
Bgl II: 5' flank of gfa2 & 3' flank of mP-1
Bam HI: flanks the lacZ gene
Sal I: cuts uniquely between the gfa2 promoter and the LacZ gene
Sph I and Hind III: cut uniquely just 3' of the mP-1 segment
Although the GFAP promoter appears to be the best choice for targeting transgene expression to astrocytes in mice, please be aware that neuronal expression has also occasionally been observed (Su et al. 2004).
Proper citation: RRID:Addgene_53126 Copy
Species: Aphelenchus avenae
Genetic Insert: AavLEA1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5708; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25120007
Proper citation: RRID:Addgene_53093 Copy
Species: Mus musculus
Genetic Insert: Ubc9
Vector Backbone Description: Backbone Size:3666; Vector Backbone:pET23a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11792325
Proper citation: RRID:Addgene_53137 Copy
Species: Aequorea victoria
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25087841
Proper citation: RRID:Addgene_53017 Copy
Species: Synthetic
Genetic Insert: LexA-QF
Vector Backbone Description: Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_46123 Copy
Genetic Insert: DR-GFPuniv reporter
Vector Backbone Description: Backbone Marker:Jasin Lab (Addgene Plasmid# 26475); Vector Backbone:pDR-GFP; Vector Types:Mammalian Expression, recombination reporter plasmid; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22121229
Comments: Description: Plasmid for in vivo recombination assays. Based on the original pDR-GFP plasmid described in Pierce et al. GenDev (1999) v13p2633.
Use data: Recipient plasmid for (homing) endonuclease target sites in order to assess in vivo activity of an endonuclease. The plasmid contains two non-functional copies of the eGFP gene: the 5’ copy is interrupted by the target site of interest and stop codons; the 3’ copy is truncated on both 5’- and 3’-end. pDR-GFP as is does not fulfill any other purpose than to receive (homing) endonuclease target sites. The recognition site for the endonuclease of interest must be cloned into the XhoI/SacI sites in the upstream eGFP gene, thus obliterating the XhoI, KpnI and SacI sites. Successful cleavage of the cloned target site generates a DSB. This triggers in vivo a homologous recombination event with the
3’ truncated copy of the eGFP which renders the 5’ copy functional. The activity of a given endonuclease can be measured by the number of GFP+ cells generated. The site that is cloned into pDR-GFP must insert a frameshift into the 5’ eGFP-copy and/or contain a stop codon in frame with the upstream sequence of the eGFP gene to assure that the ORF is not functional and no eGFP can be synthesized prior to the DSB repair event. In order to easily screen for the successful insertion of the oligonucleotide pair representing the site of interest, it is useful to integrate a restriction site that is not present in pDR-GFPuniv (e.g. a PvuII site).
Sample oligonucleotide pair:
oligo1 5’-TCGATAGGGATAACAGGGTAATACAGCTGTAAGCT-3’
oligo2 3’- ATCCCTATTGTCCCATTATGTCGACAT -5’
Please note that this plasmid functions as described in the associated publication and according to the depositing laboratory the changes to the EGFP sequence are not a concern.
Proper citation: RRID:Addgene_46085 Copy
Species: Synthetic
Genetic Insert: QFBDMD-G4AD
Vector Backbone Description: Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_46112 Copy
Species: Synthetic
Genetic Insert: QF#7m1
Vector Backbone Description: Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_46116 Copy
Species: Synthetic
Genetic Insert: QFAD184-214
Vector Backbone Description: Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_46117 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
