Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
|||||
|---|---|---|---|---|---|---|---|---|---|---|---|
|
pEN_TmiR_Luc-A Resource Report Resource Website |
RRID:Addgene_25760 | Luciferase miR-shRNA | Gentamicin | PMID:16945906 | Entry vector with TRE-driven luciferase miR-shRNA Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCC ACAGATGTATTAATCAGAGACTTCAGGCGGT | Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | Addgene | 2026-10-10 01:51:17 | 0 | ||
|
pEN_TGmiRc3 Resource Report Resource Website |
RRID:Addgene_25749 | Gentamicin | PMID:16945906 | shRNA expression; miR30-based topology; TRE Pmin promoter + GFP spacer; Entry vector backbone; +ccdB in parent; Multiple unique sites d/s of TRE | Backbone Marker:ATCC 10326362; Backbone Size:5303; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | Addgene | 2026-10-10 01:51:17 | 0 | |||
|
pEN_TmiRc3 Resource Report Resource Website 10+ mentions |
RRID:Addgene_25748 | Gentamicin | PMID:16945906 | shRNA expression; miR30-based topology; TRE Pmin promoter; Entry vector backbone; +ccdB in parent; Multiple unique sites d/s of TRE | Backbone Marker:ATCC 10326362; Backbone Size:4608; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | Addgene | 2026-10-10 01:51:17 | 12 | |||
|
pACEBac1-Q22YU3 del C3-2xStrep Resource Report Resource Website |
RRID:Addgene_170316 | Q22YU3 C-terminal truncation (Delta-C3) | Tetrahymena thermophila | Gentamicin | PMID:33632841 | Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | Deletion of C-terminal C3-finger | Addgene | 2026-10-10 01:47:25 | 0 | |
|
pDONR207-MUM2sp-ADPG2 Resource Report Resource Website |
RRID:Addgene_170723 | ARABIDOPSIS DEHISCENCE ZONE POLYGALACTURONASE 2 | Arabidopsis thaliana | Gentamicin | PMID:34059917 | For use with Three-way Multi-site Gateway Cloning (Invitrogen). | Backbone Marker:Invitrogen; Backbone Size:5585; Vector Backbone:pDONR207; Vector Types:Gateway Donor vector / entry clone; Bacterial Resistance:Gentamicin | Addgene | 2026-10-10 01:47:29 | 0 | |
|
pDONR207-MUM2sp-RglB Resource Report Resource Website |
RRID:Addgene_170721 | Rhamnogalacturonan lyase B | Aspergillus nidulans | Gentamicin | PMID:34059917 | For use with Three-way Multi-site Gateway Cloning (Invitrogen). | Backbone Marker:Invitrogen; Backbone Size:5585; Vector Backbone:pDONR207; Vector Types:Gateway Donor vector / entry clone; Bacterial Resistance:Gentamicin | Addgene | 2026-10-10 01:47:29 | 0 | |
|
pDONR207-MUM2sp-PelA Resource Report Resource Website |
RRID:Addgene_170722 | Pectin lyase A | Aspergillus nidulans | Gentamicin | PMID:34059917 | For use with Three-way Multi-site Gateway Cloning (Invitrogen). | Backbone Marker:Invitrogen; Backbone Size:5585; Vector Backbone:pDONR207; Vector Types:Gateway Donor vector / entry clone; Bacterial Resistance:Gentamicin | Addgene | 2026-10-10 01:47:29 | 0 | |
|
pDONR207-MUM2sp-Citrine-ADPG2 Resource Report Resource Website |
RRID:Addgene_170725 | ARABIDOPSIS DEHISCENCE ZONE POLYGALACTURONASE 2 | Arabidopsis thaliana | Gentamicin | PMID:34059917 | For use with Three-way Multi-site Gateway Cloning (Invitrogen). | Backbone Marker:Invitrogen; Backbone Size:5585; Vector Backbone:pDONR207; Vector Types:Gateway Donor vector / entry clone; Bacterial Resistance:Gentamicin | Addgene | 2026-10-10 01:47:29 | 0 | |
|
pPPC030.306 Resource Report Resource Website |
RRID:Addgene_171151 | J306 scRNA | Synthetic | Gentamicin | PMID:33930546 | Alternative names: pCK162, pBBR1-GmR_J3-BBa_J23117-mvaES | Backbone Marker:Jesse Zalatan; Backbone Size:6261; Vector Backbone:pPPC020.306; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Gentamicin | Addgene | 2026-10-10 01:47:34 | 0 | |
|
pPPC027.306 Resource Report Resource Website |
RRID:Addgene_171149 | J306 scRNA | Synthetic | Gentamicin | PMID:33930546 | Alternative names: pCK134, pBBR1-GmR_J3-BBa_J23117-GTPCH_J3-BBa_J23117-PTPS_J3-BBa_J23117-SR | Backbone Marker:Jesse Zalatan; Backbone Size:6261; Vector Backbone:pPPC020.306; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Gentamicin | Addgene | 2026-10-10 01:47:34 | 0 | |
|
pPPC002 Resource Report Resource Website 1+ mentions |
RRID:Addgene_171139 | J1-BBa_J23117-sfGFP | Synthetic | Gentamicin | PMID:33930546 | Alternative names: pCDP009, pUC18TminiTn7T-Gm_J1-BBa_J23117-sfGFP_Sp.pCas9-dCas9_BBa_J23107-MCP-SoxS(R93A/S101A) Used for conjugation, with pTNS1 and pRK2013 helper plasmids, to integrate J1-BBa_J23117-sfGFP, Sp.pCas9-dCas9, and BBa_J23107-MCP-SoxS(R93A/S101A) cassettes into gram-negative bacteria. Point mutation in the FRT site was observed and remained applicable with counterselection by pCK255 | Backbone Marker:Herbert Schweizer; Backbone Size:4569; Vector Backbone:pUC18TminiTn7T-Gm; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Gentamicin | Addgene | 2026-10-10 01:47:34 | 1 | |
|
pRF0G-IodoY Resource Report Resource Website |
RRID:Addgene_113645 | IodoYRS and tRNA gene | Synthetic | Gentamicin | PMID:27648665 | https://benchling.com/s/vJhpn35J | Vector Backbone:pACYC184. p15A; Vector Types:Synthetic Biology; Bacterial Resistance:Gentamicin | Addgene | 2026-10-10 01:36:36 | 0 | |
|
pOGG024 Resource Report Resource Website 1+ mentions |
RRID:Addgene_113991 | Gentamicin | PMID:30692983 | pL1V-Lv1-gent-pBBR1-ELT3. Please visit https://www.biorxiv.org/content/early/2018/08/16/392423 for bioRxiv preprint. | Vector Backbone:pL1V-Lv1-gent-pBBR1-ELT3; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin | Domesticated for Golden Gate cloning | Addgene | 2026-10-10 01:36:41 | 2 | ||
|
pFastBac-LacI-LAP-HEC1 Resource Report Resource Website |
RRID:Addgene_114033 | LacI-LAP-HEC1 | Homo sapiens | Gentamicin | PMID:26068855 | Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | none | Addgene | 2026-10-10 01:36:42 | 0 | |
|
pEN_TT 3xFLAG-MAVS Resource Report Resource Website 1+ mentions |
RRID:Addgene_158628 | MAVS | Homo sapiens | Gentamicin | PMID:33740397 | The plasmid differs from the MAVS reference sequence at 3 positions: Q93E, Q198K, and S409F. | Backbone Marker:Addgene #83274; Vector Backbone:pEN_TTmiR2c_3xFLAG; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | Addgene | 2026-10-10 01:45:03 | 1 | |
|
pEN_TT 3xFLAG-MAVS-Ala148,Ala271 Resource Report Resource Website 1+ mentions |
RRID:Addgene_158633 | MAVS | Homo sapiens | Gentamicin | PMID:33740397 | The plasmid differs from the MAVS reference sequence at 3 position (Q93E, Q198K, and S409F). This plasmid has an additional Q148A and Q271A mutation. Gene point mutations were performed using the QuikChange Kit (Agilent Cat#200517) two times on the pEN_TT 3XFLAG-MAVS plasmid: one mutagenesis to yield pEN_TT 3XFLAG-MAVS-Q148A and a second mutagenesis to yield the double mutant. | Backbone Marker:Addgene #83274; Vector Backbone:pEN_TTmiR2c_3xFLAG; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | Q148A/Q271A | Addgene | 2026-10-10 01:45:03 | 1 |
|
pEN_TT 3xFLAG-MAVS-Gln93,Ala271 Resource Report Resource Website 1+ mentions |
RRID:Addgene_158632 | MAVS | Homo sapiens | Gentamicin | PMID:33740397 | The plasmid differs from the MAVS reference sequence at 2 positions (Q198K and S409F). This plamid has an additional Q271A mutation, and amino acid 93 (glutamate, E) was mutated back to the reference (glutamine, Q). Gene point mutations were performed using the QuikChange Kit (Agilent Cat#200517) two times on the pEN_TT 3XFLAG-MAVS plasmid: one mutagenesis to yield pEN_TT 3XFLAG-MAVS-Q271A and a second mutagenesis to yield the double mutant. The clones displayed consistent off-target mutations at one of two points. Two clones with different off-target mutations were digested and the good pieces ligated together so to yield the final sequence. | Backbone Marker:Addgene #83274; Vector Backbone:pEN_TTmiR2c_3xFLAG; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | E93Q/Q271A | Addgene | 2026-10-10 01:45:03 | 1 |
|
pEN_TT 3xFLAG-MAVS-Ala148 Resource Report Resource Website 1+ mentions |
RRID:Addgene_158630 | MAVS | Homo sapiens | Gentamicin | PMID:33740397 | The plasmid differs from the MAVS reference sequence at 3 positions: Q93E, Q198K, and S409F. This plasmid has an additional Q148A mutation. Gene point mutations were performed using the QuikChange Kit (Agilent Cat#200517) on the pEN_TT 3XFLAG-MAVS plasmid. | Backbone Marker:Addgene #83274; Vector Backbone:pEN_TTmiR2c_3xFLAG; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | Q148A | Addgene | 2026-10-10 01:45:03 | 1 |
|
pOmnibac_ZZ_linker_ybbR_MAP7 Resource Report Resource Website |
RRID:Addgene_159718 | MAP7 (Microtubule Associated Protein 7) | Homo sapiens | Gentamicin | PMID:35050657 | Vector Backbone:pOmnibac; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | Addgene | 2026-10-10 01:45:18 | 0 | ||
|
pOmnibac_ZZ_linker_K560_GFP_SNAP Resource Report Resource Website |
RRID:Addgene_159720 | KIF5B (only amino acids 1-560), K560 | Homo sapiens | Gentamicin | PMID:35050657 | Vector Backbone:pOmnibac; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | Only amino acids 1-560 | Addgene | 2026-10-10 01:45:18 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
