Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Mentions:yes (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pUASt-SIK3 S563A
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_52976 SIK3 Drosophila melanogaster Ampicillin PMID:21565616 Backbone Size:8904; Vector Backbone:pUAST; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin S563A PKA phosphorylation defective 2026-08-15 01:16:26 1
pHL1756
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_53036 GFP E.coli Ampicillin PMID:23878244 The PconNoHindM12 promoter is the same as PconNoHind except for two substitution mutations at the −10 and −35 sites that moderately decrease transcription. Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:16:31 1
pSP64-hERG1a
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_53051 Potassium voltage-gated channel subfamily H member 2 Homo sapiens Ampicillin PMID:11005845 Backbone Marker:Promega; Backbone Size:3017; Vector Backbone:pSP64; Vector Types:Xenopus Oocyte Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:27 2
pCEP4-hKCNE1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_53050 Potassium voltage-gated channel subfamily E member 1 Homo sapiens Ampicillin PMID:8900283 Backbone Marker:Invitrogen; Backbone Size:10185; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:27 1
pSP64-hERG1a T623A
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_53055 Potassium voltage-gated channel subfamily H member 2 Homo sapiens Ampicillin PMID:11005845 Backbone Marker:Promega; Backbone Size:3017; Vector Backbone:pSP64; Vector Types:Xenopus Oocyte Expression; Bacterial Resistance:Ampicillin changed Threonine 623 to Alanine 2026-08-15 01:16:31 1
pSP64-hERG1a F656A
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_53054 Potassium voltage-gated channel subfamily H member 2 Homo sapiens Ampicillin PMID:11005845 Backbone Marker:Promega; Backbone Size:3017; Vector Backbone:pSP64; Vector Types:Xenopus Oocyte Expression; Bacterial Resistance:Ampicillin changed Phenylalanine 656 to Alanine 2026-08-15 01:16:27 1
pU6-gRNA
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_53062 wheat U6 promoter - gRNA wheat Ampicillin PMID:23929338 Backbone Marker:CWBIO; Backbone Size:2700; Vector Backbone:pUC-T; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:27 4
pJIT163-2NLSCas9
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_53064 Cas9 Streptococcus pyogenes Ampicillin PMID:23929338 Backbone Marker:pGREEN; Backbone Size:3741; Vector Backbone:pJIT163; Vector Types:Plant expression; Bacterial Resistance:Ampicillin Rice codon optimized 2026-08-15 01:16:31 3
pBullet-cyt-n
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_53065 Chloramphenicol and Ampicillin PMID:24905498 See http://gt.jbei.org/ for more information on the JBEI glycosyltransferase collection. Backbone Marker:JBEI; Backbone Size:8000; Vector Backbone:pBullet; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:16:27 1
pBIND-HBSP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_53113 HBSP Hepatitis B virus Ampicillin PMID:24758376 Backbone Marker:Promega; Backbone Size:6360; Vector Backbone:pBIND; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:32 1
pWUR703
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_53082 TtAgo Thermus thermophilus Spectinomycin PMID:24531762 Backbone Marker:EMD Millipore; Backbone Size:3621; Vector Backbone:pCDF-1b; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin D478A D546A 2026-08-15 01:16:27 1
pGfa2-nLac
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_53126 Gfa2 Homo sapiens Ampicillin PMID:8120611 The plasmid is a pUC18 vector containing the human GFAP sequences from -2163 to +47 (the human gfa2 segment), with the initiating ATG mutated to TTG, placed in front of the nuclear targeted E. coli lacZ gene, which in turn is followed by a fragment of the mouse protamine-1 gene. The latter supplies an intron, stabilizing 3' UTR, and a polyadenylation signal. If cloning a cDNA, it is advisable to retain the mP-1 segment. The lacZ gene can be excised by digestion with BamHI, and replaced with your gene of interest. If cloning a genomic sequence that includes an intron and polyadenylation site (this may compromise astrocyte specificity--see Su et al. 2004), the mP-1 region can also be excised, or alternatively, a number of sites flank the gfa2 segment allowing its isolation. Restriction sites that may be useful are as follows: EcoRI: flanks the gfa2, lacZ, and mP-1 segments Bgl II: 5' flank of gfa2 & 3' flank of mP-1 Bam HI: flanks the lacZ gene Sal I: cuts uniquely between the gfa2 promoter and the LacZ gene Sph I and Hind III: cut uniquely just 3' of the mP-1 segment Although the GFAP promoter appears to be the best choice for targeting transgene expression to astrocytes in mice, please be aware that neuronal expression has also occasionally been observed (Su et al. 2004). Vector Backbone:pUC18; Vector Types:Mammalian Expression, Mouse Targeting; Bacterial Resistance:Ampicillin contains -2163 to +47 (the human gfa2 segment), with the initiating ATG mutated to TTG 2026-08-15 01:16:28 5
pET15b-AavLEA1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_53093 AavLEA1 Aphelenchus avenae Ampicillin PMID:25120007 Backbone Marker:Novagen; Backbone Size:5708; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:27 4
pET23a-mUbc9
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_53137 Ubc9 Mus musculus Ampicillin PMID:11792325 Backbone Size:3666; Vector Backbone:pET23a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin protein sequence is identical to human 2026-08-15 01:16:28 2
pHL 1277
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_53017 GFP Aequorea victoria Ampicillin PMID:25087841 Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:16:27 1
pattB-synaptobrevin-14-LEXA-QF-hsp70
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46123 LexA-QF Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 1
pDR-GFPuniv
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46085 DR-GFPuniv reporter Ampicillin PMID:22121229 Description: Plasmid for in vivo recombination assays. Based on the original pDR-GFP plasmid described in Pierce et al. GenDev (1999) v13p2633. Use data: Recipient plasmid for (homing) endonuclease target sites in order to assess in vivo activity of an endonuclease. The plasmid contains two non-functional copies of the eGFP gene: the 5’ copy is interrupted by the target site of interest and stop codons; the 3’ copy is truncated on both 5’- and 3’-end. pDR-GFP as is does not fulfill any other purpose than to receive (homing) endonuclease target sites. The recognition site for the endonuclease of interest must be cloned into the XhoI/SacI sites in the upstream eGFP gene, thus obliterating the XhoI, KpnI and SacI sites. Successful cleavage of the cloned target site generates a DSB. This triggers in vivo a homologous recombination event with the 3’ truncated copy of the eGFP which renders the 5’ copy functional. The activity of a given endonuclease can be measured by the number of GFP+ cells generated. The site that is cloned into pDR-GFP must insert a frameshift into the 5’ eGFP-copy and/or contain a stop codon in frame with the upstream sequence of the eGFP gene to assure that the ORF is not functional and no eGFP can be synthesized prior to the DSB repair event. In order to easily screen for the successful insertion of the oligonucleotide pair representing the site of interest, it is useful to integrate a restriction site that is not present in pDR-GFPuniv (e.g. a PvuII site). Sample oligonucleotide pair: oligo1 5’-TCGATAGGGATAACAGGGTAATACAGCTGTAAGCT-3’ oligo2 3’- ATCCCTATTGTCCCATTATGTCGACAT -5’ Please note that this plasmid functions as described in the associated publication and according to the depositing laboratory the changes to the EGFP sequence are not a concern. Backbone Marker:Jasin Lab (Addgene Plasmid# 26475); Vector Backbone:pDR-GFP; Vector Types:Mammalian Expression, recombination reporter plasmid; Bacterial Resistance:Ampicillin E5G and K163R mutations in EGFP relative to wild-type. EGFP truncated after amino acid 163 2026-08-15 01:15:29 3
pattB-synaptobrevin-4-QFBDMD-G4AD-hsp70
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46112 QFBDMD-G4AD Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 1
pattB-synaptobrevin-7m1-QFBDADM1-hsp70
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46116 QF#7m1 Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 3
pattB-synaptobrevin-8-QFAD184-214-hsp70
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46117 QFAD184-214 Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.