Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: PECAM
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pcDNAI Neo; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: Compared to GenBank accession number L06039.1, the PECAM-1 sequence in this plasmid contains 2 nucleotide mismatches in the 5' untranslated region (UTR).
Proper citation: RRID:Addgene_42901 Copy
Species: Mus musculus
Genetic Insert: p160 myb binding protein
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1 myc-His A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14744933
Proper citation: RRID:Addgene_43 Copy
Species: Mus musculus
Genetic Insert: Hes1 Promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5597; Vector Backbone:pGL2-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7906273
Proper citation: RRID:Addgene_43806 Copy
Species: Mus musculus
Genetic Insert: mHIF-2α (P405A/P530V/N851A)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17804822
Comments: This plasmid encodes an oxygen-regulation insensitive (normoxia-stable and active) full-length murine HIF-2α.
Full-length murine HIF-2α cDNA was generated by reverse transcription-PCR and inserted into a pcDNA3 expression vector by using primers incorporated with restriction sites.
A 10-amino-acid c-myc tag was further inserted at the C terminus of the HIF-2α cDNAs by using a Pfu-PCR-based protocol. The same Pfu-PCR protocol was then used to change residues Proline 405, Proline 530 and Asparagine 851. The newly constructed plasmid was sequenced to confirm encoding of the correct protein.
This plasmid has an A94V polymorphism that does not affect protein function.
Alternate plasmid names: HIF-2α triple mutant (TM); pcDNA3 HIF-2α TM
Proper citation: RRID:Addgene_44027 Copy
Species: Mus musculus
Genetic Insert: mHIF-1α (P402A/P577A/N813A)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17804822
Comments: This plasmid encodes an oxygen-regulation insensitive (normoxia-stable and active) full-length murine HIF-1α.
Full-length murine HIF-1α cDNA was generated by reverse transcription-PCR and inserted into a pcDNA3 expression vector by using primers incorporated with restriction sites.
A 10-amino-acid c-myc tag was further inserted at the C terminus of the HIF-1α cDNAs by using a Pfu-PCR-based protocol. The same Pfu-PCR protocol was then used to change residues Proline 402, Proline 577 and Asparagine 813 to alanines. The newly constructed plasmid was sequenced to confirm encoding of the correct protein.
Alternate plasmid names: HIF-1α triple mutant (TM); pcDNA3 HIF-1α TM
Proper citation: RRID:Addgene_44028 Copy
Species: Mus musculus
Genetic Insert: Cbx5
Vector Backbone Description: Backbone Size:8600; Vector Backbone:N103; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22704655
Proper citation: RRID:Addgene_43969 Copy
Species: Mus musculus
Genetic Insert: TNF Receptor-Associated Factor 6
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pCR3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17135271
Proper citation: RRID:Addgene_43926 Copy
Species: Mus musculus
Genetic Insert: Tak1
Vector Backbone Description: Vector Backbone:pRK6-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16260783
Proper citation: RRID:Addgene_44160 Copy
Species: Mus musculus
Genetic Insert: K15 promoter (-4.8)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Mouse Targeting, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14708593
Comments: Alternate plasmid name: K15(-4.8)-pGL3
The K15 promoter was cloned from C57 BL/SJ mouse genomic DNA (isolated from tail) by PCR using the Supermix High Fidelity Kit (GIBCO). The sequences of the forward and reverse primers were
CTGAGCTACCAGCGAGACTCC (K15F1)
and
TTCCTGTCCCTAGCAAGCAGGAGAG (K15R1),
respectively. XhoI and EcoRI restriction sequences were added to the 5' end of forward and reverse primers respectively for subsequent cloning of the PCR product into PBK/CMV vector (Stratagene). The promoter fragment was then subcloned into pGL3-Basic (Promega).
The entire K15 promoter-luciferase transgene can be released by digestion with XhoI/SalI.
Proper citation: RRID:Addgene_44264 Copy
Species: Mus musculus
Genetic Insert: K15 promoter (-4.8)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Mouse Targeting, Thymidine kinase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16288281
Comments: Alternate plasmid name: K15-HSV-TK-pGL3
The K15 promoter was cloned from C57 BL/SJ mouse genomic DNA (isolated from tail) by PCR using the Supermix High Fidelity Kit (GIBCO). The sequences of the forward and reverse primers were
CTGAGCTACCAGCGAGACTCC (K15F1)
and
TTCCTGTCCCTAGCAAGCAGGAGAG (K15R1),
respectively. XhoI and EcoRI restriction sequences were added to the 5' end of forward and reverse primers respectively for subsequent cloning of the PCR product into PBK/CMV vector (Stratagene). The promoter fragment was then subcloned into pGL3-Basic (Promega) to create plasmid K15(-4.8)-pGL3 (Addgene plasmid #44264).
The HSV-1 TK reporter gene cDNA was then excised from a TK/PBSIIKS plasmid, using NotI and SalI, and cloned downstream of the K15 promoter, replacing luciferase.
The entire K15 promoter-HSV-TK transgene can be released by digestion with XhoI/SalI.
Proper citation: RRID:Addgene_44267 Copy
Species: Mus musculus
Genetic Insert: K15 promoter (-4.8)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4737; Vector Backbone:pEGFP-N2; Vector Types:Mammalian Expression, Mouse Targeting, Fluorescence microscopy; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15024388
Comments: Alternate plasmid name: pEGFP-N2 K15
The K15 promoter was cloned from C57 BL/SJ mouse genomic DNA (isolated from tail) by PCR using the Supermix High Fidelity Kit (GIBCO). The sequences of the forward and reverse primers were
CTGAGCTACCAGCGAGACTCC (K15F1)
and
TTCCTGTCCCTAGCAAGCAGGAGAG (K15R1),
respectively. XhoI and EcoRI restriction sequences were added to the 5' end of forward and reverse primers respectively for subsequent cloning of the PCR product into PBK/CMV vector (Stratagene). The promoter fragment was then subcloned into pGEGFP-N2
The entire K15 promoter-EGFP transgene can be released by digestion with XhoI/AflII.
Proper citation: RRID:Addgene_44266 Copy
Species: Mus musculus
Genetic Insert: Pyruvate Kinase M1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6800; Vector Backbone:pLHCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18337823
Proper citation: RRID:Addgene_44240 Copy
Species: Mus musculus
Genetic Insert: Pyruvate Kinase M2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6800; Vector Backbone:pLHCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18337823
Proper citation: RRID:Addgene_44239 Copy
Species: Mus musculus
Genetic Insert: TAF6
Vector Backbone Description: Vector Backbone:pMX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23503660
Proper citation: RRID:Addgene_44337 Copy
Species: Mus musculus
Genetic Insert: Kaede
Vector Backbone Description: Vector Backbone:pCS2-Kaede; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19740427
Proper citation: RRID:Addgene_39261 Copy
Species: Mus musculus
Genetic Insert: Akt(K179M)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10226029
Proper citation: RRID:Addgene_39535 Copy
Species: Mus musculus
Genetic Insert: Akt(R25C) (PH domain only)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10226029
Proper citation: RRID:Addgene_39534 Copy
Species: Mus musculus
Genetic Insert: Akt
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10226029
Proper citation: RRID:Addgene_39531 Copy
Species: Mus musculus
Genetic Insert: Akt
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10226029
Comments: mAkt-HA-ER was cloned from pWZLneo-mAkt-HA-ER from kohn et al(1998) JBC 273(19)11937-11943.
Proper citation: RRID:Addgene_39530 Copy
Species: Mus musculus
Genetic Insert: Slp2-a E11A/R32A
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4900; Vector Backbone:pGEX4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22820376
Proper citation: RRID:Addgene_40063 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
