Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:ampicillin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

328,630 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
mutpRL-TK 3xUTR
 
Resource Report
Resource Website 		RRID:Addgene_40758 3 copies of the CXCR4 small RNA target site Ampicillin PMID:21878547 Backbone Marker:Sharp Lab (http://web.mit.edu/sharplab/RNAi/Cloning.html); Vector Backbone:mutpRL-TK; Vector Types:Luciferase; Bacterial Resistance:Ampicillin mutated from TAG to CTC at nt 387–389 of the Renilla luciferase open reading frame to generate mismatches with seed positions 5, 6, and 7 of the siRNA guide strand by PCR-directed mutagenesis 2026-08-15 01:14:38 0
p3.5VPIII.EGFP.IGR2.1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_40865 Mouse vasopressin gene Mus musculus Ampicillin PMID:12944509 the following mutations are known and do not effect plasmid function: TT--5510CTTG, G5386A, A4984T,A6794G. Backbone Size:4000; Vector Backbone:pSE280; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:39 1
pAW-EGFP-4xlet-7 (pAW-AS27)
 
Resource Report
Resource Website 		RRID:Addgene_40834 Four target sites perfectly complementary to let-7 Drosophila melanogaster Ampicillin PMID:20558712 The let-7 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTA GAA CTA TAC AAC CTA CTA CCT CAT CTA GAA CTA TAC AAC CTA CTA CCT CAT as: CTA GAT GAG GTA GTA GGT TGT ATA GTT CTA GAT GAG GTA GTA GGT TGT ATA GTT This expression cassette was then sub-cloned into the Gateway vector pAW using GATEWAY cloning. Backbone Marker:Murhpy Lab, Carnegie Institution for Science; Backbone Size:7233; Vector Backbone:pAW; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Ampicillin 2026-08-15 01:14:39 0
FUW-TetO-Dppa2
 
Resource Report
Resource Website 		RRID:Addgene_40799 Dppa2 Mus musculus Ampicillin PMID:22980981 Backbone Size:8339; Vector Backbone:FUW-TetO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:39 0
pAW-EGFP-2xmiR-1 (pAW-AS-21)
 
Resource Report
Resource Website 		RRID:Addgene_40832 Two target sites perfectly complementary to miR-1 Drosophila melanogaster Ampicillin PMID:20558712 The miR-1 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTA GAC TCC ATA CTT CTT TAC ATT CCA TCT AGA CTC CAT ACT TCT TTA CAT TCC AT as: CTA GAT GGA ATG TAA AGA AGT ATG GAG TCT AGA TGG AAT GTA AAG AAG TAT GGA GT This expression cassette was then sub-cloned into the Gateway vector pAW using GATEWAY cloning. Backbone Marker:Murhpy Lab, Carnegie Institution for Science; Backbone Size:7233; Vector Backbone:pAW; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Ampicillin 2026-08-15 01:14:39 0
FUW-TetO-Esrrb
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_40798 Esrrb Mus musculus Ampicillin PMID:22980981 Backbone Size:8339; Vector Backbone:FUW-TetO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:38 4
psiCheck-2-3 x mir-34
 
Resource Report
Resource Website 		RRID:Addgene_40831 three sites partially complementary to miR-34 Drosophila melanogaster Ampicillin PMID:22055293 The psiCheck-3xmiR-34 sequences were cloned by synthesized dsDNA S: 5'-TCGAGGTGTTGATGCTAAGGTCACTGCCAGTGTTGATGCTAAGGTCACTGCCAGTGTTGATGCTAAGGTCACTGCCAGC AS: 5'-GGCCGCTGGCAGTGACCTTAGCATCAACACTGGCAGTGACCTTAGCATCAACACTGGCAGTGACCTTAGCATCAACACC the triple(3x)-repeated sequence: 5'TGGCAGTGACCTTAGCATCAACAC-3' 3'ACCGTCACTGGAATCGTAGTTGTG-5' pairs with dme-miR-34 (uggcagugugguuagcugguugug) with "seed(red) plus 3' complementary region (blue)" fashion. Backbone Marker:promega; Backbone Size:6273; Vector Backbone:psiCheck-2; Vector Types:Insect Expression, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:14:39 0
pHM6-alphasynuclein-A53T
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_40825 SNCA Homo sapiens Ampicillin PMID:10698681 Backbone Marker:Roche; Backbone Size:5450; Vector Backbone:pHM6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin A53T 2026-08-15 01:14:39 13
pHM6-alphasynuclein-WT
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_40824 SNCA Homo sapiens Ampicillin PMID:10698681 Backbone Marker:Roche; Backbone Size:5450; Vector Backbone:pHM6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:39 11
TALEN_C63
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_40788 Transcription Activator Like Effector Nuclease Xanthamonas oryzae Ampicillin MR15 is a designation vector for the Cermak et al Golden Gate system designed for expression in mammalian cells. Please acknowledge the principal investigator, Dr. Gang Bao, and include this article in your citations if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 40788" in your Materials and Methods section. Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin +63 C Terminus, Codon Optimized FokI Endonuclease 2026-08-15 01:14:38 1
pEBB XIAP Delta RING
 
Resource Report
Resource Website 		RRID:Addgene_40828 XIAP Homo sapiens Ampicillin PMID:14701799 Site-directed mutagenesis was used to to introduce a stop codon in pEBB XIAP at AA 449 (AAG to TGA). (#721) Backbone Marker:Baltimore Lab; Backbone Size:5353; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Delta RING: contains aa 1-448 2026-08-15 01:14:39 0
pCMV5-rat ERK2-K52R
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_40813 MAPK1 Rattus norvegicus Ampicillin PMID:17114285 Backbone Marker:David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin K52R 2026-08-15 01:14:39 1
pCMV5-rat ERK2-WT
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_40812 MAPK1 Rattus norvegicus Ampicillin PMID:17114285 Backbone Marker:David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin wild type 2026-08-15 01:14:39 3
pMCL-HA-MAPKK1-8E (K97M)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_40811 MAP2K1 Homo sapiens Ampicillin PMID:8052857 Backbone Marker:Invitrogen; Backbone Size:10200; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin K97M 2026-08-15 01:14:39 3
Braf
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_40775 Braf Homo sapiens Ampicillin PMID:27870838 Backbone Size:5600; Vector Backbone:pcDNA3.1-Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Starting Met removed 2026-08-15 01:14:38 17
pCMV5-rat ERK2-L73P/S151D
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_40819 MAPK1 Rattus norvegicus Ampicillin PMID:11591711 Backbone Marker:David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin L73P, S151D 2026-08-15 01:14:39 3
pCMV5-rat ERK2-S151D
 
Resource Report
Resource Website 		RRID:Addgene_40818 MAPK1 Rattus norvegicus Ampicillin PMID:11591711 Backbone Marker:David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin S151D 2026-08-15 01:14:39 0
pCMV5-rat ERK2-L73P
 
Resource Report
Resource Website 		RRID:Addgene_40817 MAPK1 Rattus norvegicus Ampicillin PMID:11591711 Backbone Marker:David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin L73P 2026-08-15 01:14:39 0
pCMV5-ratERK2-Q103A
 
Resource Report
Resource Website 		RRID:Addgene_40816 MAPK1 Rattus norvegicus Ampicillin PMID:17114285 Backbone Marker:David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Q103A 2026-08-15 01:14:39 0
pCMV5-ratERK2-I84A
 
Resource Report
Resource Website 		RRID:Addgene_40815 MAPK1 Rattus norvegicus Ampicillin PMID:17114285 Backbone Marker:David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin I84A 2026-08-15 01:14:39 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch