Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: FPPS-PTS
Vector Backbone Description: Vector Backbone:pILGFPB5A; Vector Types:Yeast Expression, Synthetic Biology, Metabolic engineering; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36990382
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.11.08.515726v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_182486 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: FPPS
Vector Backbone Description: Vector Backbone:pILGFPB5A; Vector Types:Yeast Expression, Synthetic Biology, Metabolic engineering; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36990382
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.11.08.515726v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_182482 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: FPPS(M)-LS
Vector Backbone Description: Vector Backbone:pILGFPB5A; Vector Types:Yeast Expression, Synthetic Biology, Metabolic engineering; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36990382
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.11.08.515726v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_182487 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: FPPS
Vector Backbone Description: Vector Backbone:pILGFPB5A; Vector Types:Yeast Expression, Synthetic Biology, Metabolic engineering; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36990382
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.11.08.515726v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_182491 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: FPPS-NES
Vector Backbone Description: Vector Backbone:pILGFPB5A; Vector Types:Yeast Expression, Synthetic Biology, Metabolic engineering; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36990382
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.11.08.515726v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_182490 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: FPPS
Vector Backbone Description: Vector Backbone:pILGFPB5A; Vector Types:Yeast Expression, Synthetic Biology, Metabolic engineering; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36990382
Comments: deadFPPS sequence also contains G253D mutation that was inadvertently introduced during cloning.
Please visit https://www.biorxiv.org/content/10.1101/2022.11.08.515726v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_182492 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: HIS3 pIME2
Vector Backbone Description: Backbone Size:2448; Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_191793 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: KanMX pSPR3
Vector Backbone Description: Backbone Size:2446; Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_191788 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: KanMX pSPO11
Vector Backbone Description: Backbone Size:2446; Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_191767 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: VP2C-FPPS(G)
Vector Backbone Description: Vector Backbone:pILGFPB5A; Vector Types:Yeast Expression, Synthetic Biology, Metabolic engineering; Bacterial Resistance:Ampicillin
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.11.24.517869v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_182477 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: FPPS(M)
Vector Backbone Description: Vector Backbone:pILGFPB5A; Vector Types:Yeast Expression, Synthetic Biology, Metabolic engineering; Bacterial Resistance:Ampicillin
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.11.24.517869v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_182437 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: FPPS(M)-NES
Vector Backbone Description: Vector Backbone:pILGFPB5A; Vector Types:Yeast Expression, Synthetic Biology, Metabolic engineering; Bacterial Resistance:Ampicillin
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.11.24.517869v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_182436 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Ago- Dcr
Vector Backbone Description: Backbone Size:7959; Vector Backbone:pESC; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: AGO1 and DCR1 genes were amplified from S. castellii gDNA using primersatac gcggccgc aacgatgtcatccaattcgg+ and atac gcggccgc agcacataaactctttgttc, respectively.
Plasmid pESC-LEU was converted to leu2::NAT derivative via short-homology in vivo replacement using PCR product generated using primers AAGCAAGGATTTTCTTAACTTCTTCGGCGACAGCATCACCGACTTCGGTGc agc tga agc ttc gta cgc+tttttccaataggtggttagcaatcgtcttactttctaacttttcttacct agg cca cta gtg gat ctg and pAG25 template.
AGO1 was cloned into NotI site of pESC-NAT to yield pESC-NAT-AGO1 plasmid.
DCR1 was cloned into ApaI/XhoI site of pESC-NAT-AGO1 to yield pESC-NAT-AGO1-DCR1 plasmid.
Proper citation: RRID:Addgene_160381 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: N1199
Vector Backbone Description: Backbone Size:4984; Vector Backbone:PSV3; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: The plasmid was constructed by gene synthesis and cloning by Genewiz.
Proper citation: RRID:Addgene_160386 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: PDE1
Vector Backbone Description: Backbone Marker:Genetics. 2009 Sep; 183(1): 365–383.; Backbone Size:3825; Vector Backbone:pLND46; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: Please note plasmid contains the following mutations T114A, K153E, I201T and N306S in PDE1. Depositor confirms plasmid is functional.
Proper citation: RRID:Addgene_160388 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: L-A Gag-Pol
Vector Backbone Description: Backbone Marker:J Virol . 1993 May;67(5):2764-71. doi: 10.1128/JVI.67.5.2764-2771.1993.; Backbone Size:9854; Vector Backbone:PJD1223; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: pJD1223-NAT was constructed by short-homology in vivo replacement of TRP1 on pJD1223 (J Virol
. 1993 May;67(5):2764-71) with NAT PCR product generated using primers TATTGAGCACGTGAGTATACGTGATTAAGCACACAAAGGCAGCTTGGAGTcagctgaagcttcgtacgc and
caagtgcacaaacaatacttaaataaatactactcagtaataacctattttaggccactagtggatctg from pAG25.
Proper citation: RRID:Addgene_160390 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: N1199
Vector Backbone Description: Backbone Size:3704; Vector Backbone:pAG25; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: 2.8 kb dsRNA species gel purified from yJM 1199 and ligated to PC3 oligo (/5Phos/GG ATC CCG GGA ATT CGG TAA TAC GAC TCA CTA TAT TTT TAT AGT GAG TCG TAT TA). After reverse transcription and strand annealing, cDNA amplified with PC2 primer (CCG AAT TCC CGG GAT CC )to yield a 2.8 kb fragment. Fragment phosphorylated and ligated to pAG25 digested with EcoRV and phosphatase treated. Clones checked with restriction digest and sequencing. Near full length N1199 cDNA
Proper citation: RRID:Addgene_160379 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Grx5-GFP1-10
Vector Backbone Description: Backbone Marker:PMID: 7737504; Vector Backbone:p404TDH3; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28241148
Comments: Split GFP was synthesized using gBlocks based on these references: Stephanie Cabantous et al., 2005 Nature Methods and Christine J. Smoyer et al. 2016 JCB.
Proper citation: RRID:Addgene_91952 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: ScSEIPIN
Vector Backbone Description: Backbone Size:12460; Vector Backbone:pMDC84; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26362606
Comments: The sequences and maps of pMDC vectors can be obtained from the following website. http://www.botinst.uzh.ch/en/research/development/grossnik/vectors/MarkdGatewayVectors.html
Proper citation: RRID:Addgene_96984 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: ScSEIPIN
Vector Backbone Description: Backbone Size:12460; Vector Backbone:pMDC84; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26362606
Comments: The sequences and maps of pMDC vectors can be obtained from the following website. http://www.botinst.uzh.ch/en/research/development/grossnik/vectors/MarkdGatewayVectors.html
Proper citation: RRID:Addgene_96985 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
