Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
Linked Free PcPTS Resource Report Resource Website |
RRID:Addgene_182486 | FPPS-PTS | Saccharomyces cerevisiae | Ampicillin | PMID:36990382 | Please visit https://www.biorxiv.org/content/10.1101/2022.11.08.515726v1 for bioRxiv preprint. | Vector Backbone:pILGFPB5A; Vector Types:Yeast Expression, Synthetic Biology, Metabolic engineering; Bacterial Resistance:Ampicillin | 2026-08-15 01:24:19 | 0 | |
|
Coexpressed Free NES Resource Report Resource Website |
RRID:Addgene_182482 | FPPS | Saccharomyces cerevisiae | Ampicillin | PMID:36990382 | Please visit https://www.biorxiv.org/content/10.1101/2022.11.08.515726v1 for bioRxiv preprint. | Vector Backbone:pILGFPB5A; Vector Types:Yeast Expression, Synthetic Biology, Metabolic engineering; Bacterial Resistance:Ampicillin | 2026-08-15 01:24:19 | 0 | |
|
Linked Free ClLIS1 (M) Resource Report Resource Website |
RRID:Addgene_182487 | FPPS(M)-LS | Saccharomyces cerevisiae | Ampicillin | PMID:36990382 | Please visit https://www.biorxiv.org/content/10.1101/2022.11.08.515726v1 for bioRxiv preprint. | Vector Backbone:pILGFPB5A; Vector Types:Yeast Expression, Synthetic Biology, Metabolic engineering; Bacterial Resistance:Ampicillin | 2026-08-15 01:24:19 | 0 | |
|
Coexpressed Free GFP-NES Resource Report Resource Website |
RRID:Addgene_182491 | FPPS | Saccharomyces cerevisiae | Ampicillin | PMID:36990382 | Please visit https://www.biorxiv.org/content/10.1101/2022.11.08.515726v1 for bioRxiv preprint. | Vector Backbone:pILGFPB5A; Vector Types:Yeast Expression, Synthetic Biology, Metabolic engineering; Bacterial Resistance:Ampicillin | 2026-08-15 01:24:19 | 0 | |
|
Linked Free (PT)4P Resource Report Resource Website |
RRID:Addgene_182490 | FPPS-NES | Saccharomyces cerevisiae | Ampicillin | PMID:36990382 | Please visit https://www.biorxiv.org/content/10.1101/2022.11.08.515726v1 for bioRxiv preprint. | Vector Backbone:pILGFPB5A; Vector Types:Yeast Expression, Synthetic Biology, Metabolic engineering; Bacterial Resistance:Ampicillin | 2026-08-15 01:24:19 | 0 | |
|
Coexpressed Free deadFPPS-NES Resource Report Resource Website |
RRID:Addgene_182492 | FPPS | Saccharomyces cerevisiae | Ampicillin | PMID:36990382 | deadFPPS sequence also contains G253D mutation that was inadvertently introduced during cloning. Please visit https://www.biorxiv.org/content/10.1101/2022.11.08.515726v1 for bioRxiv preprint. | Vector Backbone:pILGFPB5A; Vector Types:Yeast Expression, Synthetic Biology, Metabolic engineering; Bacterial Resistance:Ampicillin | 2026-08-15 01:24:19 | 0 | |
|
pFA6a-HISMX6-pIME2 Resource Report Resource Website |
RRID:Addgene_191793 | HIS3 pIME2 | Saccharomyces cerevisiae | Ampicillin | Backbone Size:2448; Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin | 2026-08-15 01:24:21 | 0 | |||
|
pFA6a-kanMX6-pSPR3 Resource Report Resource Website |
RRID:Addgene_191788 | KanMX pSPR3 | Saccharomyces cerevisiae | Ampicillin | Backbone Size:2446; Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin | 2026-08-15 01:24:21 | 0 | |||
|
pFA6a-kanMX6-pSPO11 Resource Report Resource Website |
RRID:Addgene_191767 | KanMX pSPO11 | Saccharomyces cerevisiae | Ampicillin | Backbone Size:2446; Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin | 2026-08-15 01:24:21 | 0 | |||
|
Coexpressed VLP NES (G) Resource Report Resource Website |
RRID:Addgene_182477 | VP2C-FPPS(G) | Saccharomyces cerevisiae | Ampicillin | Please visit https://www.biorxiv.org/content/10.1101/2022.11.24.517869v1 for bioRxiv preprint. | Vector Backbone:pILGFPB5A; Vector Types:Yeast Expression, Synthetic Biology, Metabolic engineering; Bacterial Resistance:Ampicillin | 2026-08-15 01:24:28 | 0 | ||
|
Coexpressed Free NES (M) Resource Report Resource Website |
RRID:Addgene_182437 | FPPS(M) | Saccharomyces cerevisiae | Ampicillin | Please visit https://www.biorxiv.org/content/10.1101/2022.11.24.517869v1 for bioRxiv preprint. | Vector Backbone:pILGFPB5A; Vector Types:Yeast Expression, Synthetic Biology, Metabolic engineering; Bacterial Resistance:Ampicillin | 2026-08-15 01:24:28 | 0 | ||
|
Linked Free NES (M) Resource Report Resource Website |
RRID:Addgene_182436 | FPPS(M)-NES | Saccharomyces cerevisiae | Ampicillin | Please visit https://www.biorxiv.org/content/10.1101/2022.11.24.517869v1 for bioRxiv preprint. | Vector Backbone:pILGFPB5A; Vector Types:Yeast Expression, Synthetic Biology, Metabolic engineering; Bacterial Resistance:Ampicillin | 2026-08-15 01:24:28 | 0 | ||
|
pESC-NAT-Ago-Dcr Resource Report Resource Website |
RRID:Addgene_160381 | Ago- Dcr | Saccharomyces cerevisiae | Ampicillin | AGO1 and DCR1 genes were amplified from S. castellii gDNA using primersatac gcggccgc aacgatgtcatccaattcgg+ and atac gcggccgc agcacataaactctttgttc, respectively. Plasmid pESC-LEU was converted to leu2::NAT derivative via short-homology in vivo replacement using PCR product generated using primers AAGCAAGGATTTTCTTAACTTCTTCGGCGACAGCATCACCGACTTCGGTGc agc tga agc ttc gta cgc+tttttccaataggtggttagcaatcgtcttactttctaacttttcttacct agg cca cta gtg gat ctg and pAG25 template. AGO1 was cloned into NotI site of pESC-NAT to yield pESC-NAT-AGO1 plasmid. DCR1 was cloned into ApaI/XhoI site of pESC-NAT-AGO1 to yield pESC-NAT-AGO1-DCR1 plasmid. | Backbone Size:7959; Vector Backbone:pESC; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:24:29 | 0 | ||
|
N1199 launching Resource Report Resource Website |
RRID:Addgene_160386 | N1199 | Saccharomyces cerevisiae | Ampicillin | The plasmid was constructed by gene synthesis and cloning by Genewiz. | Backbone Size:4984; Vector Backbone:PSV3; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:24:29 | 0 | ||
|
pGAL-PDE1 Resource Report Resource Website |
RRID:Addgene_160388 | PDE1 | Saccharomyces cerevisiae | Ampicillin | Please note plasmid contains the following mutations T114A, K153E, I201T and N306S in PDE1. Depositor confirms plasmid is functional. | Backbone Marker:Genetics. 2009 Sep; 183(1): 365–383.; Backbone Size:3825; Vector Backbone:pLND46; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:24:29 | 0 | ||
|
PJD1223 Resource Report Resource Website |
RRID:Addgene_160390 | L-A Gag-Pol | Saccharomyces cerevisiae | Ampicillin | pJD1223-NAT was constructed by short-homology in vivo replacement of TRP1 on pJD1223 (J Virol . 1993 May;67(5):2764-71) with NAT PCR product generated using primers TATTGAGCACGTGAGTATACGTGATTAAGCACACAAAGGCAGCTTGGAGTcagctgaagcttcgtacgc and caagtgcacaaacaatacttaaataaatactactcagtaataacctattttaggccactagtggatctg from pAG25. | Backbone Marker:J Virol . 1993 May;67(5):2764-71. doi: 10.1128/JVI.67.5.2764-2771.1993.; Backbone Size:9854; Vector Backbone:PJD1223; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:24:30 | 0 | ||
|
pAG25-1199 cDNA Resource Report Resource Website |
RRID:Addgene_160379 | N1199 | Saccharomyces cerevisiae | Ampicillin | 2.8 kb dsRNA species gel purified from yJM 1199 and ligated to PC3 oligo (/5Phos/GG ATC CCG GGA ATT CGG TAA TAC GAC TCA CTA TAT TTT TAT AGT GAG TCG TAT TA). After reverse transcription and strand annealing, cDNA amplified with PC2 primer (CCG AAT TCC CGG GAT CC )to yield a 2.8 kb fragment. Fragment phosphorylated and ligated to pAG25 digested with EcoRV and phosphatase treated. Clones checked with restriction digest and sequencing. Near full length N1199 cDNA | Backbone Size:3704; Vector Backbone:pAG25; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:24:30 | 0 | ||
|
p404-Grx5-GFP1-10 Resource Report Resource Website |
RRID:Addgene_91952 | Grx5-GFP1-10 | Saccharomyces cerevisiae | Ampicillin | PMID:28241148 | Split GFP was synthesized using gBlocks based on these references: Stephanie Cabantous et al., 2005 Nature Methods and Christine J. Smoyer et al. 2016 JCB. | Backbone Marker:PMID: 7737504; Vector Backbone:p404TDH3; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:22:26 | 0 | |
|
pMDC84-ScSEIPIN Resource Report Resource Website |
RRID:Addgene_96984 | ScSEIPIN | Saccharomyces cerevisiae | Kanamycin | PMID:26362606 | The sequences and maps of pMDC vectors can be obtained from the following website. http://www.botinst.uzh.ch/en/research/development/grossnik/vectors/MarkdGatewayVectors.html | Backbone Size:12460; Vector Backbone:pMDC84; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:22:32 | 0 | |
|
pMDC84-ScSEIPIN-Ndelta Resource Report Resource Website |
RRID:Addgene_96985 | ScSEIPIN | Saccharomyces cerevisiae | Kanamycin | PMID:26362606 | The sequences and maps of pMDC vectors can be obtained from the following website. http://www.botinst.uzh.ch/en/research/development/grossnik/vectors/MarkdGatewayVectors.html | Backbone Size:12460; Vector Backbone:pMDC84; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin | N-terminal 39 nucleotides were deleted from yeast SEIPIN | 2026-08-15 01:22:31 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
