Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Other
Genetic Insert: A. majus Rosea coding region
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI
Proper citation: RRID:Addgene_68194 Copy
Species: Other
Genetic Insert: empty vector
Vector Backbone Description: Backbone Marker:self-made; derived from pGreenII generated at the JIC; Vector Backbone:pDGB1_omega2; Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23669743
Proper citation: RRID:Addgene_68235 Copy
Species: Other
Genetic Insert: Solanum lycopersicum intergenic region
Vector Backbone Description: Backbone Marker:self-made; derived from pGreenII generated at the JIC; Vector Backbone:pDGB1_alpha2; Vector Types:Synthetic Biology, Unspecified; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23669743
Comments: insert can be released with BsmBI
Proper citation: RRID:Addgene_68233 Copy
Species: Other
Genetic Insert: dCas9
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26030444
Comments: Contains NLS sequences at the N- and C-terminus of the dCas9 protein. The C-terminal NLS immediately preceedes the 3xFLAG tag
Proper citation: RRID:Addgene_68417 Copy
Species: Other
Genetic Insert: dCas9
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26030444
Comments: Contains NLS sequences at the N- and C-terminus of the dCas9 protein. The C-terminal NLS immediately preceedes the 3xFLAG tag
Proper citation: RRID:Addgene_68416 Copy
Species: Other
Genetic Insert: Cypridina Luciferase-2A-Venus YFP
Vector Backbone Description: Backbone Marker:Life Technologies; Vector Backbone:pLenti6.3/TO/V5-DEST; Vector Types:Lentiviral, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26030444
Comments: Reporters are separated by 2A "self-cleaving" peptides. The reporter cassette is under the control of a minimal CMV promoter, preceeded by a casette of nine (ATCTAGATCGCCCGTCCCCT)AGG sites. The Tet-reponsive promoter and Gateway cloning sites were removed from the parent vector.
Proper citation: RRID:Addgene_68414 Copy
Species: Other
Genetic Insert: L7Ae
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26030444
Comments: Contains an N-terminal 3xNLS cassette
Proper citation: RRID:Addgene_68421 Copy
Species: Other
Genetic Insert: MS2
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26030444
Comments: Contains an N-terminal 3xNLS cassette. Contains a single copy of the MS2 protein fused to mCherry.
Proper citation: RRID:Addgene_68420 Copy
Species: Other
Genetic Insert: MSP3.1
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6654; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26701602
Proper citation: RRID:Addgene_68506 Copy
Species: Other
Genetic Insert: DBP-RII
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6654; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26701602
Proper citation: RRID:Addgene_68529 Copy
Species: Other
Genetic Insert: DBP
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6654; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26701602
Proper citation: RRID:Addgene_68528 Copy
Species: Other
Genetic Insert: RIPR
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6654; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26701602
Proper citation: RRID:Addgene_68526 Copy
Species: Other
Genetic Insert: CyRPA
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6654; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26701602
Proper citation: RRID:Addgene_68525 Copy
Species: Other
Genetic Insert: Pv34
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6654; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26701602
Proper citation: RRID:Addgene_68523 Copy
Species: Other
Genetic Insert: GAMA
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6654; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26701602
Proper citation: RRID:Addgene_68522 Copy
Species: Other
Genetic Insert: PVX_110950
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6654; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26701602
Proper citation: RRID:Addgene_68539 Copy
Species: Other
Genetic Insert: PVX_116775
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6654; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26701602
Proper citation: RRID:Addgene_68535 Copy
Species: Other
Genetic Insert: PVX_084815
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6654; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26701602
Proper citation: RRID:Addgene_68533 Copy
Species: Other
Genetic Insert: PVX_081550
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6654; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26701602
Proper citation: RRID:Addgene_68532 Copy
Species: Other
Genetic Insert: MTRAP
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6654; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26701602
Proper citation: RRID:Addgene_68530 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.