Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 134 showing 2661 ~ 2680 out of 328,630 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_40880

    This resource has 1+ mentions.

http://www.addgene.org/40880

Species: Homo sapiens
Genetic Insert: Smac(1-60)mCherry
Vector Backbone Description: Backbone Size:5523; Vector Backbone:pcDNA3.1; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20493813

Proper citation: RRID:Addgene_40880 Copy   


http://www.addgene.org/37504

Vector Backbone Description: Backbone Size:6053; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning. 8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases. 8O adds a TEV-cleavable His6-mOCR tag to the N-terminus of your protein. mOCR can enhance the solubility of your protein of interest. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_37504 Copy   


  • RRID:Addgene_37625

http://www.addgene.org/37625

Species: Homo sapiens
Genetic Insert: human GLIS1
Vector Backbone Description: Backbone Size:10184; Vector Backbone:pCXLE-gw; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23193063

Proper citation: RRID:Addgene_37625 Copy   


http://www.addgene.org/37505

Vector Backbone Description: Backbone Size:5729; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning. 8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases. 8HR adds a TEV-cleavable His6 and a strep tag to the N terminus of your protein. The dual affinity tags can help to purify difficult proteins. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. Visit http://qb3.berkeley.edu/qb3/macrolab/ for more information on this vector can be found through

Proper citation: RRID:Addgene_37505 Copy   


http://www.addgene.org/37506

Vector Backbone Description: Backbone Size:5693; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning. 8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases. 8R adds a TEV-cleavable strep tag to the N-terminus of your protein. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ .

Proper citation: RRID:Addgene_37506 Copy   


  • RRID:Addgene_37464

    This resource has 1+ mentions.

http://www.addgene.org/37464

Vector Backbone Description: Backbone Marker:Andrew Fire (Addgene plasmid # 1494); Vector Backbone:pPD95.75; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22022276

Proper citation: RRID:Addgene_37464 Copy   


  • RRID:Addgene_37460

http://www.addgene.org/37460

Species: HPV
Genetic Insert: HPV 8E6
Vector Backbone Description: Backbone Size:6550; Vector Backbone:CMV bam neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22553330
Comments: The 8E6 template was given to us by Harold Pfister who originally cloned the HPV8 genome. (J. Virology 1986, Pfister H. et al.)

Proper citation: RRID:Addgene_37460 Copy   


  • RRID:Addgene_37509

    This resource has 1+ mentions.

http://www.addgene.org/37509

Species: Homo sapiens
Genetic Insert: NLRC5
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22490867

Proper citation: RRID:Addgene_37509 Copy   


  • RRID:Addgene_37457

http://www.addgene.org/37457

Species: HPV
Genetic Insert: HPV 6bE6
Vector Backbone Description: Backbone Size:6550; Vector Backbone:CMV bam neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22553330

Proper citation: RRID:Addgene_37457 Copy   


  • RRID:Addgene_37452

    This resource has 1+ mentions.

http://www.addgene.org/37452

Genetic Insert: Histone, 2A element, rabies B19 glycoprotein
Vector Backbone Description: Vector Backbone:AAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Comments: Please note that there are 2 mutations in Histone, D26G and V119I. These mutations should not affect plasmid function.

Proper citation: RRID:Addgene_37452 Copy   


  • RRID:Addgene_37449

http://www.addgene.org/37449

Species: HPV
Genetic Insert: HPV 5E6
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:9387; Vector Backbone:pLenti 6.3/V5 DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22553330

Proper citation: RRID:Addgene_37449 Copy   


http://www.addgene.org/37605

Species: Homo sapiens
Genetic Insert: E6AP III
Vector Backbone Description: Backbone Size:7800; Vector Backbone:PHAGE-P CMVt N-HA GAW; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22645313

Proper citation: RRID:Addgene_37605 Copy   


  • RRID:Addgene_37445

    This resource has 1+ mentions.

http://www.addgene.org/37445

Species: HPV
Genetic Insert: HPV 16E6no*
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:9387; Vector Backbone:pLenti 6.3/V5 DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22553330

Proper citation: RRID:Addgene_37445 Copy   


  • RRID:Addgene_37566

http://www.addgene.org/37566

Species: A. victoria
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:Lim Lab; Vector Backbone:pZ with ColE origin; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23878244

Proper citation: RRID:Addgene_37566 Copy   


  • RRID:Addgene_37447

http://www.addgene.org/37447

Species: HPV
Genetic Insert: HPV 6bE6
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:9387; Vector Backbone:pLenti 6.3/V5 DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22553330

Proper citation: RRID:Addgene_37447 Copy   


  • RRID:Addgene_37561

    This resource has 1+ mentions.

http://www.addgene.org/37561

Species: Homo sapiens
Genetic Insert: MET
Vector Backbone Description: Backbone Marker:Eric Campeau Addgene Plasmid 17448; Backbone Size:8608; Vector Backbone:pLentiCMV GFP Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_37561 Copy   


  • RRID:Addgene_37560

    This resource has 10+ mentions.

http://www.addgene.org/37560

Species: Homo sapiens
Genetic Insert: MET
Vector Backbone Description: Backbone Marker:Eric Campeau Addgene Plasmid 17448; Backbone Size:8608; Vector Backbone:pLentiCMV GFP Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_37560 Copy   


http://www.addgene.org/37608

Species: Homo sapiens
Genetic Insert: Myc
Vector Backbone Description: Backbone Size:8344; Vector Backbone:pHAGE-B CMV N-EGFP GAW; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22645313

Proper citation: RRID:Addgene_37608 Copy   


  • RRID:Addgene_37558

http://www.addgene.org/37558

Species: N/A
Genetic Insert: PreScission protease cleavage site-S tag-TEV site-Z
Vector Backbone Description: Backbone Size:6515; Vector Backbone:pSY07; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22431751

Proper citation: RRID:Addgene_37558 Copy   


  • RRID:Addgene_37438

http://www.addgene.org/37438

Species: HPV
Genetic Insert: HPV 8E6
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pB-actin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22553330

Proper citation: RRID:Addgene_37438 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X