Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pLenti CMV/TO Hygro empty (w214-1) Resource Report Resource Website 10+ mentions |
RRID:Addgene_17484 | Ampicillin | PMID:19657394 | Backbone Size:8709; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:44 | 19 | ||||
|
pQCXIB empty (w335-1) Resource Report Resource Website 1+ mentions |
RRID:Addgene_17487 | Ampicillin | PMID:19657394 | Backbone Size:7027; Vector Backbone:pQCXIB; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:45 | 7 | ||||
|
px459 sgAtg5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_175023 | ATG5 | Homo sapiens | Ampicillin | PMID:32850845 | Backbone Size:9174; Vector Backbone:px459; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:46 | 1 | ||
|
pcDNA3-TORCAR-NES Resource Report Resource Website 1+ mentions |
RRID:Addgene_175015 | TORCAR-NES | Ampicillin | PMID:33257668 | Backbone Marker:Invitrogen; Backbone Size:5472; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:46 | 1 | |||
|
pAAV.hSyn.FLEX.iGluSnFR3.v857.PDGFR.codonopt Resource Report Resource Website 1+ mentions |
RRID:Addgene_175180 | pAAV hSyn FLEX iGluSnFR3 v857.PDGFR | Mus musculus | Ampicillin | PMID:37142767 | Backbone Size:4852; Vector Backbone:pAAV hSyn FLEX; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:48 | 1 | ||
|
pBRIT HA/FLAG Resource Report Resource Website 1+ mentions |
RRID:Addgene_17519 | Ampicillin | PMID:18066051 | Backbone Size:5247; Vector Backbone:pBRIT-LoxP-HA/FLAG-puro; Vector Types:Mammalian Expression, Retroviral, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:48 | 1 | ||||
|
pBRIT Pax7 FLAG Resource Report Resource Website 1+ mentions |
RRID:Addgene_17521 | Pax7 | Mus musculus | Ampicillin | PMID:18066051 | Backbone Size:5200; Vector Backbone:pBRIT-LoxP-HA/FLAG-puro; Vector Types:Mammalian Expression, Retroviral, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:48 | 1 | ||
|
pcDNA3.1-mBeRFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_175173 | mBeRFP | Ampicillin | PMID:34610277 | Vector Backbone:pcDNA3.1(+); Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:48 | 1 | |||
|
CAG FUCCI Resource Report Resource Website 1+ mentions |
RRID:Addgene_175266 | FUCCI | Synthetic | Ampicillin | PMID:35266986 | Vector Backbone:pISce-Dest; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:48 | 1 | ||
|
pPB-EF1a-MegaGate-DD-Hygro Resource Report Resource Website 1+ mentions |
RRID:Addgene_175267 | Ampicillin | PMID:35474898 | Vector Backbone:PiggyBac; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:48 | 1 | ||||
|
pCD/NL-BH*DDD Resource Report Resource Website 10+ mentions |
RRID:Addgene_17531 | HIV-1 Gag/Pol, Tat, Rev | HIV-1 | Ampicillin | PMID:14722277 | Backbone Size:2246; Vector Backbone:pcDNA3.1 (Invitrogen); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:49 | 27 | ||
|
pCoPURO Resource Report Resource Website 10+ mentions |
RRID:Addgene_17533 | Puromycine Acetyl Transferase | Ampicillin | PMID:14513552 | Backbone Marker:Invitrogen; Backbone Size:0; Vector Backbone:pCoHYGRO; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:49 | 13 | |||
|
pJH2930 Resource Report Resource Website 1+ mentions |
RRID:Addgene_175283 | DAF-16a | Caenorhabditis elegans | Ampicillin | PMID:24671950 | Backbone Marker:stratagene; Backbone Size:6000; Vector Backbone:pBSK; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:48 | 1 | ||
|
pAAV-rtTA Resource Report Resource Website 1+ mentions |
RRID:Addgene_175274 | Reverse tetracycline-controlled transactivator (rtTA) | Synthetic | Ampicillin | PMID:34824475 | Backbone Size:3951; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:48 | 3 | ||
|
pAAV-SynaptoTAG2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_175275 | EGFP-Synaptobrevin-2; tdTomato | Other | Ampicillin | PMID:34824475 | Sequencing may be difficult due to secondary structure/dimerization. The following primers have been used in the Xu lab: 5': actcagcgctgcctcagtc (upstream of tdTomato) 3': ggccatgttgttgtcctcggaggaggcggtgc (in tdTomato) 5': gggcatggcaccggcagcaccggcagcggcagc (in tdTomato) 3': gctgaacttgtggccgtttacgtcg (in EGFP) 3': cagggtcagcttgccgtaggtggcatcg (in EGFP) | Backbone Size:4561; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:48 | 1 | |
|
AAV-Syn-NS1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_175276 | Nonstructural protein 1 (NS1) of YFV-17D; NLS-dTomato | Yellow fever virus strain 17D | Ampicillin | PMID:34824475 | Backbone Size:4591; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:48 | 1 | ||
|
AAV-TRE-NS1NF Resource Report Resource Website 1+ mentions |
RRID:Addgene_175279 | NS1 | Yellow fever virus strain 17D | Ampicillin | PMID:34824475 | Backbone Size:3901; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:48 | 2 | ||
|
pPB-EF1a-MegaGate-DD-Blast Resource Report Resource Website 1+ mentions |
RRID:Addgene_175271 | Ampicillin | PMID:35474898 | Selectable marker is flanked by Rox sites for excision with Dre recombinase. | Vector Backbone:PiggyBac; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:48 | 2 | |||
|
pAAV-DIO-NS1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_175273 | Nonstructural protein 1 (NS1) of YFV-17D | Yellow fever virus strain 17D | Ampicillin | PMID:34824475 | Backbone Size:4470; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:48 | 1 | ||
|
pH6HTC_ENO1-Halo Resource Report Resource Website 1+ mentions |
RRID:Addgene_175330 | ENO1 | Homo sapiens | Ampicillin | Please note in Addgene's NGS result identified a single ambiguous base in the insert adjacent to the TEV site. This base is a mixed population of A (48.4%) and G (51.2%). If it is an A the amino acid changes from G to E. Depositor confirmed this mutation does not affect plasmid function. Please visit https://doi.org/10.1101/2021.11.08.467743 for bioRxiv preprint. | Vector Backbone:pH6HTC_minus_cer-region; Vector Types:Bacterial Expression, Cell Free Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:49 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
