Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: hM3D (Gq)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5059; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17360345
Comments: These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.
Proper citation: RRID:Addgene_45547 Copy
Genetic Insert: PSPPH_0329
Vector Backbone Description: Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21556065
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_45425 Copy
Species: Synthetic
Genetic Insert: Rmet_1702
Vector Backbone Description: Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21556065
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_45417 Copy
Species: Synthetic
Genetic Insert: Maqu_0582
Vector Backbone Description: Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21556065
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_45419 Copy
Species: Synthetic
Genetic Insert: Maqu_3494
Vector Backbone Description: Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21556065
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_45418 Copy
Species: jellyfish
Genetic Insert: mit-2mutAEQ
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5300; Vector Backbone:pcDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22671130
Comments: Note that numbering of the aequorin mutations in this plasmid is relative to the valine at position 8 in the original sequence from Inouye et al., PNAS 82, 3154 (1985) PubMed ID: 3858813. When compared to this sequence (GenBank ID AAA27720.1) the mutations at N28L and D119A would correspond to N35L and D126A.
Proper citation: RRID:Addgene_45539 Copy
Species: Synthetic
Genetic Insert: DKAR-Nuc
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21795686
Comments: FRET-based PKD activation reporter (DKAR). Contains a PKD-specific substrate and phosphoamino acid-binding domain linking CFP and YFP. Upon phosphorylation by PKD, FRET is reduced.
Proper citation: RRID:Addgene_45499 Copy
Species: Mus musculus
Genetic Insert: alpha Klotho
Vector Backbone Description: Backbone Size:5710; Vector Backbone:pCR3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:26881702
Proper citation: RRID:Addgene_45532 Copy
Species: Synthetic
Genetic Insert: PFL_1028
Vector Backbone Description: Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21556065
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_45413 Copy
Species: Synthetic
Genetic Insert: Rmet_4866
Vector Backbone Description: Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21556065
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_45415 Copy
Species: Synthetic
Genetic Insert: PFL_1158
Vector Backbone Description: Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21556065
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_45414 Copy
Species: Synthetic
Genetic Insert: PL2x2_5
Vector Backbone Description: Backbone Size:5370; Vector Backbone:pET29b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_45491 Copy
Species: Synthetic
Genetic Insert: FR55
Vector Backbone Description: Backbone Size:5370; Vector Backbone:pET29b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_45490 Copy
Species: Synthetic
Genetic Insert: CAR-GECO1
Vector Backbone Description: Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452507
Proper citation: RRID:Addgene_45493 Copy
Species: Synthetic
Genetic Insert: R-GECO1.2
Vector Backbone Description: Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452507
Proper citation: RRID:Addgene_45494 Copy
Species: Homo sapiens
Genetic Insert: eIF4GI transcript variant 2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19114555
Comments: For diagnostic digest, an additional PvuI digestion is necessary to distinguish the insert from the vector because of their similar sizes.
The EIF4G1 translation contains M432V compared to NP_937884 (NM_198241.2); however the nucleotide change resulting in the amino acid change is more conserved between species, and it is located between functional domains of eIF4G1 (PABP-binding site and eIF4E-binding site), and does not affect its function as a translational factor
Proper citation: RRID:Addgene_45640 Copy
Species: Homo sapiens
Genetic Insert: HDAC4
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17873280
Proper citation: RRID:Addgene_45636 Copy
Species: Nostoc punctiforme
Genetic Insert: NpuDnaEC14
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4597; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23974115
Comments: There are 2 mismatches between Addgene's quality control and depositor's reference sequence. These changes are in backbone region and should not affect function.
Proper citation: RRID:Addgene_45595 Copy
Species: Mus musculus
Genetic Insert: c-Myc
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7143; Vector Backbone:pcDNA DEST40; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15048125
Comments: Alternate plasmid names: pD40-His-c-Myc; pcDNA-DEST40 Myc wt
This His6-tagged c-Myc plasmid was created by PCR amplification of the coding sequence for wild-type murine c-Myc2 from the CMVMyc plasmid (Hann et al., Genes Dev. 1994, PMID: 7958908) with a CACC 5′ extension added to the 5′ primer for cloning into the TOPO entry clone from Invitrogen (Carlsbad, CA). This sequence was then moved into the pDEST-40 mammalian expression vector using Gateway technology (Invitrogen), creating pD40-His-c-Myc.
For plasmid usage information, see the associated article (Yeh et al. Nat Cell Biol. 2004) as well as Arnold et al. EMBO 2009 (PMID: 19131971).
Proper citation: RRID:Addgene_45597 Copy
Species: Mus musculus
Genetic Insert: Lpl in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19793993
Comments: The Lpl fragment was amplified by RT-PCR using the following primer pair:
TGCTGTGCAAAGAGAAGAGC
CGGACACAAAGTTAGCACCA
For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation.
Please note that Addgene's sequencing results match bp# 3249-3900 of NM_008509.2, not bp# 3169-3826 as indicated on plasmid map. The plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_45630 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
