Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: DEPTOR shRNA 2
Vector Backbone Description: Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19446321
Comments: mouse DEPTOR shRNA 2
TRCN0000110159; NM_145470.1-1165s1c1
shRNA oligo sequence is - 5'-CCGGGCAAGGAAGACATTCACGATTCTCGAGAATCGTGAATGTCTTCCTTGCTTTTTG
Proper citation: RRID:Addgene_21338 Copy
Species: Mus musculus
Genetic Insert: DEPTOR shRNA 1
Vector Backbone Description: Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19446321
Comments: mouse DEPTOR shRNA 1
TRCN0000110157; NM_145470.1-1164s1c1
shRNA oligo sequence is - 5'-CCGGCGCAAGGAAGACATTCACGATCTCGAGATCG
TGAATGTCTTCCTTGCGTTTTTG
Proper citation: RRID:Addgene_21337 Copy
Species: Mus musculus
Genetic Insert: Int3
Vector Backbone Description: Backbone Size:6700; Vector Backbone:pLHTC; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9576833
Proper citation: RRID:Addgene_21330 Copy
Species: Mus musculus
Genetic Insert: Hoxb7 promoter
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KS+; Vector Types:Promoter can be used to make transgenic mice; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10068631
Comments: Hoxb7 promoter #25, DNA #M126. The Hoxb7promoter fragment (sequences from −1316 to +81 of the Hoxb7gene), obtained from Dr Jacqueline Deschamps, was excised from the pGEM-Blue vector with KpnI and AvaI,
the ends blunted, and recloned into the EcoRV site of pBluescript KS+ in both orientations.
Proper citation: RRID:Addgene_21294 Copy
Species: Mus musculus
Genetic Insert: rictor shRNA 1
Vector Backbone Description: Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19150980
Comments: mouse rictor shRNA 1
shRNA oligo sequence is 5'- CCGGGCCAGTAAGATGGGAATCATTCTCGAGAATGATTCCCATCTTACTGGCTTTTTG -3'
Proper citation: RRID:Addgene_21341 Copy
Species: Mus musculus
Genetic Insert: raptor shRNA 2
Vector Backbone Description: Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19446321
Comments: mouse raptor shRNA 2
shRNA oligo sequence is 5'- CCGGGCCCGAGTCTGTGAATGTAATCTCGAGATTACATTCACAGACTCGGGCTTTTTG -3'
Proper citation: RRID:Addgene_21340 Copy
Species: Mus musculus
Genetic Insert: Notch4
Vector Backbone Description: Backbone Size:7600; Vector Backbone:pHyTc; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_21468 Copy
Species: Mus musculus
Genetic Insert: mitogen-activated protein kinase kinase 4
Vector Backbone Description: Backbone Marker:Bruce Mayer Lab; Backbone Size:6100; Vector Backbone:pEBG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7997269
Comments: missing first 10 amino acids
Proper citation: RRID:Addgene_21563 Copy
Species: Mus musculus
Genetic Insert: Stra8 promoter
Vector Backbone Description: Backbone Size:7048; Vector Backbone:pLLU2G; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18719224
Comments: This is a 3rd generation lentiviral plasmid.
Proper citation: RRID:Addgene_21619 Copy
Species: Mus musculus
Genetic Insert: Bmi-1
Vector Backbone Description: Backbone Marker:D. Baltimore; Backbone Size:9941; Vector Backbone:FUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18371338
Comments: Bmi-1 cDNA cloned into pIRES-eGFP first. The Bmi1-ires-eGFP was then cut out and cloned into FUGW.
Proper citation: RRID:Addgene_21577 Copy
Species: Mus musculus
Genetic Insert: TNF receptor-associated factor 6
Vector Backbone Description: Backbone Marker:Dr. David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15456887
Proper citation: RRID:Addgene_21624 Copy
Species: Mus musculus
Genetic Insert: GFP-ING2(pHD)
Vector Backbone Description: Backbone Size:0; Vector Backbone:n/a; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12859901
Proper citation: RRID:Addgene_21589 Copy
Species: Mus musculus
Genetic Insert: ROSA26 G19
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBlueScript KS(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9108056
Comments: Subclone of the original lambda phage, representing the ROSA26 locus, from 129S4 mice.
For more information visit -
http://research.mssm.edu/soriano/lab
Proper citation: RRID:Addgene_21711 Copy
Species: Mus musculus
Genetic Insert: myelin protein zero intron1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19179536
Proper citation: RRID:Addgene_21630 Copy
Species: Mus musculus
Genetic Insert: Mcl-1
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:6307; Vector Backbone:p3XFlag-CMV10; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20385764
Proper citation: RRID:Addgene_32979 Copy
Species: Mus musculus
Genetic Insert: MEF2D
Vector Backbone Description: Backbone Marker:M. Tanaka; Backbone Size:7500; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_32963 Copy
Species: Mus musculus
Genetic Insert: MEF2D
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:6310; Vector Backbone:p3XFlag-CMV-14; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_32965 Copy
Species: Mus musculus
Genetic Insert: Nkx2-5
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2700; Vector Backbone:pEntr3c; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21415370
Proper citation: RRID:Addgene_32969 Copy
Species: Mus musculus
Genetic Insert: hepatic nuclear factor 4 alpha
Vector Backbone Description: Vector Backbone:pGCDNsam; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21716291
Proper citation: RRID:Addgene_33002 Copy
Species: Mus musculus
Genetic Insert: forkhead box A1
Vector Backbone Description: Vector Backbone:pGCDNsam; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21716291
Proper citation: RRID:Addgene_33003 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
