Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: beta-catenin
Vector Backbone Description: Backbone Size:7000; Vector Backbone:pT3-EF1a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17785413
Comments: This plasmid is in the pT3-EF1a vector which contains loxP sites flanking the inverted repeats of SB (sleeping beauty) sequence. Therefore this plasmid cannot not used with Cre for in vivo studies.
Proper citation: RRID:Addgene_31785 Copy
Vector Backbone Description: Backbone Size:9119; Vector Backbone:pGBT; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21552255
Comments: The plasmid contains Tol2 transposon mini ITRs.
Proper citation: RRID:Addgene_31828 Copy
Species: Rattus norvegicus
Genetic Insert: GCaMP5G
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3955; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23035093
Proper citation: RRID:Addgene_31788 Copy
Genetic Insert: GFP (lacking ATG start codon)
Vector Backbone Description: Backbone Marker:Koen De Smet Imperial College Medical School; Backbone Size:5497; Vector Backbone:pSODIT; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:11250077
Comments: Plasmid can also be grown in mycobacteria.
Proper citation: RRID:Addgene_31820 Copy
Species: Homo sapiens
Genetic Insert: NeuroD2
Vector Backbone Description: Backbone Marker:home made/Crabtree lab; Backbone Size:8851; Vector Backbone:N174; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21753754
Proper citation: RRID:Addgene_31822 Copy
Species: Mus musculus
Genetic Insert: MEF2-dependent promoter (-307 to -242 of Nur77/NR4A1)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5600; Vector Backbone:pGL2-basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7565789
Comments: The minimal c-fos promoter fragment was cloned into the SmaI and BglII sites of pGL2 basic. The wild-type RSRF sequence of the -307 to -242 Nur77/NR4A1 promoter region was cloned in to the SalI site of this SmaI/BglII fragment.
Proper citation: RRID:Addgene_31818 Copy
Species: Mus musculus
Genetic Insert: Erk5
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11046135
Proper citation: RRID:Addgene_31817 Copy
Species: Mus musculus
Genetic Insert: miR-9/9* and miR-124
Vector Backbone Description: Backbone Marker:Open Biosystems; Backbone Size:11315; Vector Backbone:pLemir; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21753754
Proper citation: RRID:Addgene_31779 Copy
Species: Homo sapiens
Genetic Insert: FADD
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21183682
Proper citation: RRID:Addgene_31814 Copy
Species: Homo sapiens
Genetic Insert: MEK1
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pCS2CherDest; Vector Types:Expression Vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19269286
Comments: Expression clone for generating mRNA encoding mcherry-actMEKK.
Proper citation: RRID:Addgene_31880 Copy
Genetic Insert: rsTagRFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3999; Vector Backbone:pBAD/His-B; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20659687
Proper citation: RRID:Addgene_31927 Copy
Genetic Insert: Medium-FT
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4012; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19136976
Proper citation: RRID:Addgene_31911 Copy
Species: Homo sapiens
Genetic Insert: myelin transcription factor 1-like
Vector Backbone Description: Backbone Marker:home made/Crabtree lab; Backbone Size:7998; Vector Backbone:pTight-N174; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21753754
Proper citation: RRID:Addgene_31877 Copy
Genetic Insert: Fast-FT
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4012; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19136976
Proper citation: RRID:Addgene_31910 Copy
Genetic Insert: Fast-FT
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3125; Vector Backbone:pTRE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19136976
Proper citation: RRID:Addgene_31913 Copy
Species: Homo sapiens
Genetic Insert: human cytochrome C oxidase subunit VIII
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4646; Vector Backbone:N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20212155
Proper citation: RRID:Addgene_31879 Copy
Genetic Insert: Slow-FT
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19136976
Proper citation: RRID:Addgene_31912 Copy
Species: Homo sapiens
Genetic Insert: LOVS1K
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pTriEx 3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21802009
Comments: Cloning primers:
5' end:
CATGCCATGGGGACTAGTTTGGCTACTACACTTGAACGTATTGA
3' end:
CTAGCTAGCCAGTGAGTGGATGCCAGGGTTG
LOVS1K should be co-expressed with Orai1, such as Orai1 CFP (http://www.addgene.org/19757) or Orai1 YFP (http://www.addgene.org/19756/) deposited by Anjana Rao.
Proper citation: RRID:Addgene_31981 Copy
Species: Homo sapiens
Genetic Insert: Cul5
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5070; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18187417
Proper citation: RRID:Addgene_31984 Copy
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmcherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Kanamycin
Defining Citation: PMID:20169111
Comments: Please note: the orientation of the MCS within this plasmid places mCherry on the c-terminus of your gene of interest.
Proper citation: RRID:Addgene_31907 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
