Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: HsFBXO28
Vector Backbone Description: Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:39456142
Proper citation: RRID:Addgene_228945 Copy
Species: Homo sapiens
Genetic Insert: ΔHsFBXO28
Vector Backbone Description: Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:39456142
Proper citation: RRID:Addgene_228946 Copy
Species: Homo sapiens
Genetic Insert: Cas9-ZRANB3
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.64898/2026.02.19.706875 for bioRxiv preprint.
Proper citation: RRID:Addgene_252011 Copy
Species: Homo sapiens
Genetic Insert: Cas9-BLM(2-194)
Vector Backbone Description: Vector Backbone:lentiCRISPRv2; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.64898/2026.02.19.706875 for bioRxiv preprint.
Proper citation: RRID:Addgene_252012 Copy
Species: Homo sapiens
Genetic Insert: LACZ
Vector Backbone Description: Vector Backbone:PQCXIP; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41392169
Proper citation: RRID:Addgene_252254 Copy
Species: Homo sapiens
Genetic Insert: Cas9-BARD1(32-117)
Vector Backbone Description: Vector Backbone:lentiCRISPRv2; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.64898/2026.02.19.706875 for bioRxiv preprint.
Proper citation: RRID:Addgene_252013 Copy
Species: Homo sapiens
Genetic Insert: Cas9
Vector Backbone Description: Vector Backbone:pT7; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.64898/2026.02.19.706875 for bioRxiv preprint.
Proper citation: RRID:Addgene_252015 Copy
Species: Homo sapiens
Genetic Insert: Cas9-BARD1
Vector Backbone Description: Vector Backbone:pT7; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.64898/2026.02.19.706875 for bioRxiv preprint.
Proper citation: RRID:Addgene_252016 Copy
Species: Homo sapiens
Genetic Insert: Flotillin-2
Vector Backbone Description: Vector Backbone:pLenti; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41477822
Proper citation: RRID:Addgene_252028 Copy
Species: Homo sapiens
Genetic Insert: Cas9-ZNF146
Vector Backbone Description: Vector Backbone:lentiCRISPRv2; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.64898/2026.02.19.706875 for bioRxiv preprint.
Proper citation: RRID:Addgene_252000 Copy
Species: Homo sapiens
Genetic Insert: Cas9-RAD18
Vector Backbone Description: Vector Backbone:lentiCRISPRv2; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.64898/2026.02.19.706875 for bioRxiv preprint.
Proper citation: RRID:Addgene_252002 Copy
Species: Homo sapiens
Genetic Insert: cofilin 1
Vector Backbone Description: Backbone Size:5428; Vector Backbone:pcDNA 3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22421043
Comments: SSR is super resistent to cofilin shRNA (silent mutations in 2 different seqences). Silent mutations protect expression against 2 human shRNAs (CCACCTTTGTCAAGATGCT and AAGTCTTCAACGCCAGAGGAG) targeting different sequences in cofilin.
Proper citation: RRID:Addgene_252616 Copy
Species: Homo sapiens
Genetic Insert: Cas9-BARD1
Vector Backbone Description: Vector Backbone:lentiCRISPRv2; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.64898/2026.02.19.706875 for bioRxiv preprint.
Proper citation: RRID:Addgene_251999 Copy
Species: Homo sapiens
Genetic Insert: 60 kDa heat shock protein, mitochondrial
Vector Backbone Description: Backbone Size:5382; Vector Backbone:pET21D; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_250362 Copy
Species: Homo sapiens
Genetic Insert: LOC6polyGly
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_250409 Copy
Species: Homo sapiens
Genetic Insert: hKCNJ2
Vector Backbone Description: Vector Backbone:pAAV with one trs deleted ITR and CAG promoter; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40818454
Proper citation: RRID:Addgene_246995 Copy
Species: Homo sapiens
Genetic Insert: hKCNJ2
Vector Backbone Description: Vector Backbone:pAAV with one trs deleted ITR and CAG promoter; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40818454
Proper citation: RRID:Addgene_246998 Copy
Species: Homo sapiens
Genetic Insert: negative control sgRNA targeting region between inverted repeats of Distal Junction
Vector Backbone Description: Vector Backbone:pGL3-U6-sgRNA-EGFP; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39797762
Proper citation: RRID:Addgene_247546 Copy
Species: Homo sapiens
Genetic Insert: asRILpolyGly
Vector Backbone Description: Vector Backbone:PAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_250411 Copy
Species: Homo sapiens
Genetic Insert: uGIPpolyG
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_250410 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
