Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pcDNA3 NT3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_39981 | Neurotrophin 3 | Mus musculus | Ampicillin | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:32 | 1 | |||
|
pGEX4T-1 Slp2-a C2AB Resource Report Resource Website |
RRID:Addgene_40058 | Slp2-a C2AB | Mus musculus | Ampicillin | PMID:22820376 | Backbone Marker:Promega; Backbone Size:4900; Vector Backbone:pGEX4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | C2AB domains only | 2026-08-15 01:14:33 | 0 | |
|
pEGFP-C1 Slp2-a E11A/R32A Resource Report Resource Website |
RRID:Addgene_40055 | Slp2-a E11A/R32A | Mus musculus | Kanamycin | PMID:22820376 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Glutamate 11 to Alanine, Arginine 32 to Alanine | 2026-08-15 01:14:33 | 0 | |
|
pEGFP-C1 Slp2-a C2B Resource Report Resource Website |
RRID:Addgene_40053 | Slp2-a C2B | Mus musculus | Kanamycin | PMID:22820376 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | C2B domain | 2026-08-15 01:14:33 | 0 | |
|
pEGFP-C1 Slp2-a C2A Resource Report Resource Website |
RRID:Addgene_40052 | Slp2-a C2A | Mus musculus | Kanamycin | PMID:22820376 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | C2A domains | 2026-08-15 01:14:33 | 0 | |
|
Ubc-megf10-GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_40207 | Megf10 | Mus musculus | Ampicillin | PMID:22407321 | Vector Backbone:pUb-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:34 | 2 | ||
|
CD40L-MIEG-hCD4 (hCD4-CD40L) Resource Report Resource Website 1+ mentions |
RRID:Addgene_40355 | CD40L | Mus musculus | Ampicillin | PMID:19405121 | The CD40-ligand (CD40L)-expressing retroviral vector was constructed by PCR amplification of cDNA from anti-CD3 activated mouse T cells with the following primers for CD40-ligand: sense 5'-CTTTCAGTCAGCATGATAGAAACA-3' and antisense 5'-TCAGAGTTTGAGTAAGCCAAAAGA-3'; these primers were used to amplify the complete coding region of mouse CD40 ligand. The CD40-ligand gene was then reamplified with primers containing XhoI and NotI sites and then cloned via XhoI and NotI sites into a retroviral vector expressing human CD4. | Backbone Marker:Addgene plasmid 40569; Vector Backbone:MIEG-hCD4; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:35 | 2 | |
|
pMCP-MU-Luc (MCP-1 mut promoter in pGL3-basic) Resource Report Resource Website |
RRID:Addgene_40325 | MCP-1 promoter (mutated) | Mus musculus | Ampicillin | PMID:10973278 | Note: Addgene NGS results identified an extra ~500 bp region upstream of the expected promoter, which contains a CMV enhancer feature. It is unknown what impact the region may have on plasmid function, but the extra sequence appears to have been present in the original sample received by Addgene. A plasmid containing the mouse MCP-1 promoter driving luciferase (pMCP-Luc) was constructed from pGL3-basic (Promega, Madison, WI) and a PCR-generated MCP-1 promoter fragment. A proofreading competent Taq reagent (AccuTaq, Sigma) was used to ensure high fidelity PCR. 1.2 kb of the MCP-1 promoter (GenBank Accession no. U12470) was obtained by PCR of C57BL/6 mouse DNA with the following primers: 5′–TCATGTATATGGCTTTCCAGGTCT–3′ (sense strand, distal to transcription start) 5′–TGCACTTCTGGCTGCTCTGAG GCA–3′ (antisense strand, proximal to transcription start) The PCR product terminates 28-bp downstream of the MCP-1 TATA site. XmaI and XhoI sites were added to the MCP-1 promoter by a second round of PCR with the primers: 5′–ATATCACCCGGGTCATGTATATGGCTTTCCAGGTCT–3′ 5′–TAGATTCTCGAGTGCACTTCTGGCTGCTCTGAGGCA–3′ and XmaI and XhoI were used to clone the MCP-1 promoter fragment into pGL3-basic. For the construction of the MCP-1 mutant promoter, the BCL-6 site was mutated by a two step PCR–based strategy using the above flanking primers and the following complementary primers to mutate the BCL-6 site: 5′–TCTCTCTTCCACTTCCT[TT]AAACA–3′ 5′–TGTTT[AA]AGGAAGTGGAAGAGAGA–3′ (mutated bases are in brackets) The mutant promoter was cloned into pGL3 via XhoI and XmaI. The wild-type and mutant MCP-1 promoter sequences were verified by sequencing. | Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | contains MCP-1 promoter region through the nucleotides 28-bp downstream of the MCP-1 TATA site. Sequence has two base changes from the wild-type MCP-1 promoter around the -150 bp position (see note below). | 2026-08-15 01:14:35 | 0 |
|
2C::tdTomato Reporter Resource Report Resource Website 10+ mentions |
RRID:Addgene_40281 | 2C Promoter (2-cell stage promoter) | Mus musculus | Ampicillin | PMID:22722858 | The CMV promoter from the parent pcDNA plasmid was removed with MluI and HindIII, leaving approx. 6400kb backbone. The 2C promoter was put in its place (730bp) using the same sites. Hence, the full plasmid is 7129bp. The promoter is active shortly after fertilization of mouse embryos to about the 8-cell stage. It is also on in a subset of MESCs & miPSCs. | Backbone Marker:Invitrogen/Life Tech; Backbone Size:6400; Vector Backbone:pcDNA Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:35 | 15 | |
|
FUGW-H1-Syndecan-1 shRNA (UTR) Resource Report Resource Website 1+ mentions |
RRID:Addgene_40623 | Syndecan-1 shRNA(UTR) | Mus musculus | Ampicillin | PMID:22936997 | This shRNA plasmid was generated by inserting the hairpin oligonucleotides into the FUGW-H1 lentiviral construct. | Backbone Size:10130; Vector Backbone:FUGW-H1; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:38 | 2 | |
|
AMPK-γ1-HA Resource Report Resource Website 1+ mentions |
RRID:Addgene_40605 | AMPK-γ1 | Mus musculus | Kanamycin | PMID:17012231 | AMPK-γ1 insert has Kozak sequence embedded at 5'-terminus and a stop codon at the 3'-terminus. The FLAG of the pCMV-Tag4a backbone is out of frame. | Backbone Size:4300; Vector Backbone:pCMV-Tag4A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:37 | 1 | |
|
AMPK-β2-FLAG Resource Report Resource Website 1+ mentions |
RRID:Addgene_40603 | AMPK-β2 | Mus musculus | Kanamycin | PMID:17012231 | Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag4A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:37 | 1 | ||
|
AMPK-β1-FLAG Resource Report Resource Website |
RRID:Addgene_40602 | AMPK-β1 | Mus musculus | Kanamycin | PMID:17012231 | Backbone Size:4300; Vector Backbone:pCMV-Tag4A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:37 | 0 | ||
|
AMPK-β2-MYC Resource Report Resource Website |
RRID:Addgene_40606 | AMPK-β2 | Mus musculus | Kanamycin | PMID:17012231 | Does not express well. Minimal kozak only GCCATGGG. | Backbone Size:4300; Vector Backbone:pCMV-Tag5a; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:37 | 0 | |
|
pEMB44 / Mouse_LRRK2_1_342 Resource Report Resource Website |
RRID:Addgene_40555 | Lrrk2 | Mus musculus | Ampicillin | Backbone Marker:Emerald; Vector Backbone:pEMB44; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin | WT | 2026-08-15 01:14:37 | 0 | ||
|
p3.5VPIII.EGFP.IGR2.1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_40865 | Mouse vasopressin gene | Mus musculus | Ampicillin | PMID:12944509 | the following mutations are known and do not effect plasmid function: TT--5510CTTG, G5386A, A4984T,A6794G. | Backbone Size:4000; Vector Backbone:pSE280; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:39 | 1 | |
|
FUW-TetO-Dppa2 Resource Report Resource Website |
RRID:Addgene_40799 | Dppa2 | Mus musculus | Ampicillin | PMID:22980981 | Backbone Size:8339; Vector Backbone:FUW-TetO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:39 | 0 | ||
|
FUW-TetO-Esrrb Resource Report Resource Website 1+ mentions |
RRID:Addgene_40798 | Esrrb | Mus musculus | Ampicillin | PMID:22980981 | Backbone Size:8339; Vector Backbone:FUW-TetO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:38 | 4 | ||
|
FUW-TetO-Ctcf Resource Report Resource Website 1+ mentions |
RRID:Addgene_40801 | Ctcf | Mus musculus | Ampicillin | PMID:22980981 | Backbone Size:8339; Vector Backbone:FUW-TetO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:39 | 1 | ||
|
pDEST47-Arl13b17 Resource Report Resource Website |
RRID:Addgene_40875 | Arl13b | Mus musculus | Ampicillin | PMID:21976698 | In Larkins et al (2011), this is plasmid "Arf domain GFP tagged" or "Arl domain-GFP" as referenced in Figure 2. Amino acids 1-199 of Arl13b were Gateway cloned into pcDNA-DEST47. This effectively deleted the novel C-terminal domain. | Backbone Marker:Invitrogen; Backbone Size:7780; Vector Backbone:pcDNA-DEST47; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | contains Arl13b amino acids 1-199 | 2026-08-15 01:14:39 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
