Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pBbA5k-EPL45 Resource Report Resource Website |
RRID:Addgene_45413 | PFL_1028 | Synthetic | Kanamycin | PMID:21556065 | Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions. | Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:23 | 0 | |
|
pBbA5k-EPL52 Resource Report Resource Website |
RRID:Addgene_45415 | Rmet_4866 | Synthetic | Kanamycin | PMID:21556065 | Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions. | Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:23 | 0 | |
|
pBbA5k-EPL48 Resource Report Resource Website |
RRID:Addgene_45414 | PFL_1158 | Synthetic | Kanamycin | PMID:21556065 | Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions. | Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:23 | 0 | |
|
PL2x2_5 Resource Report Resource Website |
RRID:Addgene_45491 | PL2x2_5 | Synthetic | Kanamycin | Backbone Size:5370; Vector Backbone:pET29b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | changed E30Y of Di-IV_5_PL2x2_6 | 2026-08-15 01:15:24 | 0 | ||
|
FR55 Resource Report Resource Website |
RRID:Addgene_45490 | FR55 | Synthetic | Kanamycin | Backbone Size:5370; Vector Backbone:pET29b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | changed F14L and added Gly at N-terminus of Di-I_5_FR28 | 2026-08-15 01:15:24 | 0 | ||
|
CMV-CAR-GECO1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45493 | CAR-GECO1 | Synthetic | Ampicillin | PMID:23452507 | Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | R-GECO1 E163V/I166V/V174T/M176I/F222I/A302P | 2026-08-15 01:15:24 | 3 | |
|
CMV-R-GECO1.2 Resource Report Resource Website 10+ mentions |
RRID:Addgene_45494 | R-GECO1.2 | Synthetic | Ampicillin | PMID:23452507 | Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | R-GECO1 M164R/I166V/V174L/F222L/N267S/S270T/I330M/L419I | 2026-08-15 01:15:24 | 25 | |
|
FDA60 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45606 | FDA60 | Synthetic | Ampicillin | Backbone Size:5358; Vector Backbone:peT21b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:25 | 1 | |||
|
CMV-O-GECO1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46025 | O-GECO1 | Synthetic | Ampicillin | PMID:23452507 | Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | R-GECO1 N45I/A73V/S142P/M146R/M223T/M339L/K378R/E386V/K397N | 2026-08-15 01:15:28 | 2 | |
|
CMV-mito-CAR-GECO1 Resource Report Resource Website 10+ mentions |
RRID:Addgene_46022 | CAR-GECO1 | Synthetic | Ampicillin | PMID:23452507 | The vector of the CMV-mito-CAR-GECO1 is based on the mitATeam1.03 pcDNA plasmid reported here: (http://www.pnas.org/content/106/37/15651.abstract). | Backbone Marker:Invitrogen; Backbone Size:5600; Vector Backbone:pcDNA3.1 (-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | R-GECO1 E163V/I166V/V174T/M176I/F222I/A302P | 2026-08-15 01:15:28 | 14 |
|
CMV-mito-R-GECO1 Resource Report Resource Website 10+ mentions |
RRID:Addgene_46021 | R-GECO1 | Synthetic | Ampicillin | PMID:23452507 | The vector of the CMV-mito-R-GECO1 is based on the mitATeam1.03 pcDNA plasmid reported here: (http://www.pnas.org/content/106/37/15651.abstract). | Backbone Marker:Invitrogen; Backbone Size:5600; Vector Backbone:pcDNA3.1 (-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Substitutions relative to the mApple-derived analogue of GCaMP3: T47A/L60P/E61V/S63V/E64S/R81G/K83R/Y134C/M158L/N164aD/V228A/ S290P/I366F/K380N/S404G/N414D/E430V | 2026-08-15 01:15:28 | 22 |
|
pCAG-TALEN-G-pA Resource Report Resource Website |
RRID:Addgene_45962 | TALEN | Synthetic | Ampicillin | Backbone Size:2500; Vector Backbone:pBluescript; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:27 | 0 | |||
|
pGR-L3S2P00 Resource Report Resource Website |
RRID:Addgene_46005 | L3S2P00 Terminator | Synthetic | Ampicillin | PMID:23727987 | Backbone Size:5047; Vector Backbone:pGR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:28 | 0 | ||
|
pENTR-L4-pTF-L1R Resource Report Resource Website |
RRID:Addgene_45954 | pTF promoter | Synthetic | Kanamycin | PMID:21761975 | More information can be found at http://medweb2.unige.ch/salmon/lentilab/lentivectors.html | Backbone Marker:Invitrogen; Backbone Size:4777; Vector Backbone:pDONRP4P1R; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:27 | 0 | |
|
PU6::klp-12_sgRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_46170 | klp-12 targeting sgRNA | Synthetic | Ampicillin | PMID:23817069 | gRNA target sequence GATCCACAAGTTACAATTGG | Backbone Size:2641; Vector Backbone:pUC57; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:29 | 7 | |
|
PU6::unc-119_sgRNA Resource Report Resource Website 10+ mentions |
RRID:Addgene_46169 | unc-119 targeting sgRNA | Synthetic | Ampicillin | PMID:23817069 | gRNA target sequence GAATTTTCTGAAATTAAAGA | Backbone Size:2641; Vector Backbone:pUC57; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:30 | 29 | |
|
Peft-3::cas9-SV40_NLS::tbb-2 3'UTR Resource Report Resource Website 10+ mentions |
RRID:Addgene_46168 | codon optimized Cas9_SV40 NLS with intron | Synthetic | Ampicillin | PMID:23817069 | Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3 | Backbone Size:2641; Vector Backbone:pUC57; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | intron inserted at position 3113-3163, and SV40 NLS inserted from position 5192-5227 | 2026-08-15 01:15:29 | 47 |
|
pPTQF#7-hsp70 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46136 | QF#7 | Synthetic | Ampicillin | PMID:25581800 | Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. | Backbone Size:5176; Vector Backbone:pPTGAL4; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:29 | 1 | |
|
pCasper4-tubulin-IVS-Syn21-QSco-p10 Resource Report Resource Website |
RRID:Addgene_46132 | QSco | Synthetic | Ampicillin | PMID:25581800 | Please note that Addgene's sequencing results found a single nucleotide mismatch at bp# 5036 in the tubulin promoter when compared to the full plasmid sequence. The depositing laboratory states that this difference is not a concern for the function of the plasmid. Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. | Backbone Size:11431; Vector Backbone:pCasper4-tubulinP; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:29 | 0 | |
|
pAC-2-G4BDMD-QFAD Resource Report Resource Website |
RRID:Addgene_46091 | G4BDMD-QFAD | Synthetic | Ampicillin | PMID:25581800 | Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. | Backbone Size:6445; Vector Backbone:pPAC5C-PL; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:29 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.