Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: BCL2 interacting protein 3 like
Vector Backbone Description: Backbone Size:6078; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_100762 Copy
Species: Homo sapiens
Genetic Insert: BCL2 interacting protein 3 like
Vector Backbone Description: Backbone Size:6078; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_100763 Copy
Species: Homo sapiens
Genetic Insert: CPI-17-T38A-NES
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_100779 Copy
Species: Homo sapiens
Genetic Insert: p110 CUX1 (amino acids 878-1505)
Vector Backbone Description: Vector Backbone:pXJ42; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18347061
Proper citation: RRID:Addgene_100814 Copy
Genetic Insert: TGCTGTTGACAGTGAGCGTCTTCTCGTTTGAAACTTTGAATAGTGAAGCCA
Vector Backbone Description: Vector Backbone:pTRIPZ; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24618719
Proper citation: RRID:Addgene_100815 Copy
Species: Homo sapiens
Genetic Insert: Lenti-sh-Nix
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:7032; Vector Backbone:pLKO.1-puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33044904
Proper citation: RRID:Addgene_100770 Copy
Species: Homo sapiens
Genetic Insert: CPI-17-NLS
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_100776 Copy
Species: Homo sapiens
Genetic Insert: CPI-17-T38E-NLS
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_100778 Copy
Species: rabies virus
Genetic Insert: rabies virus CVS N2c strain glycoprotein gene
Vector Backbone Description: Backbone Marker:Connie Cepko; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_100811 Copy
Species: Homo sapiens
Genetic Insert: Lenti-sh-BNIP3-FL
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:7032; Vector Backbone:pLKO.1-puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_100771 Copy
Species: Homo sapiens
Genetic Insert: CPI-17
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_100772 Copy
Species: Homo sapiens
Genetic Insert: CLTC
Vector Backbone Description: Vector Backbone:pMALPre-His; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28954824
Proper citation: RRID:Addgene_100748 Copy
Species: Homo sapiens
Genetic Insert: CD8A
Vector Backbone Description: Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28954824
Proper citation: RRID:Addgene_100742 Copy
Species: Homo sapiens
Genetic Insert: AP2B1
Vector Backbone Description: Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28954824
Proper citation: RRID:Addgene_100743 Copy
Species: Homo sapiens
Genetic Insert: beta2 adaptin
Vector Backbone Description: Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28954824
Proper citation: RRID:Addgene_100745 Copy
Genetic Insert: Fyn
Vector Backbone Description: Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28954824
Proper citation: RRID:Addgene_100741 Copy
Species: Homo sapiens
Genetic Insert: Nix-MaoB
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29511336
Proper citation: RRID:Addgene_100757 Copy
Species: Homo sapiens
Genetic Insert: GST-Nix
Vector Backbone Description: Backbone Marker:GE Healthcare Life Sciences; Backbone Size:4900; Vector Backbone:pGEX; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Use E. coli LB21 for expression
Proper citation: RRID:Addgene_100759 Copy
Species: Homo sapiens
Genetic Insert: Nix-_TM
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29511336
Proper citation: RRID:Addgene_100755 Copy
Species: Homo sapiens
Genetic Insert: Nix-CytoB5
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29511336
Proper citation: RRID:Addgene_100756 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.