Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
p3xFLAG-CMV-Tlr4(Lps) Resource Report Resource Website |
RRID:Addgene_27149 | toll-like receptor 4(Lps) | Mus musculus | Ampicillin | PMID:9851930 | Backbone Marker:Sigma; Backbone Size:4732; Vector Backbone:p3xFLAG-CMV-8; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | changed Proline 712 to Histidine. Native signal peptide sequence (original amino acids 1-24) was removed for cloning. | 2026-08-15 01:13:00 | 0 | |
|
pRK5-Flag-HA-Merlin Resource Report Resource Website 1+ mentions |
RRID:Addgene_27104 | Merlin | Mus musculus | Ampicillin | PMID:20178741 | Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:59 | 1 | ||
|
pRK5-Merlin-Flag-HA Resource Report Resource Website |
RRID:Addgene_27103 | Merlin | Mus musculus | Ampicillin | PMID:20178741 | Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:59 | 0 | ||
|
pLKO.1-MKL1/2 shRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_27161 | shRNA MKL1+2 | Mus musculus | Ampicillin | PMID:20466732 | shRNA sequence for knockdown of both MKL1 and MKL2: CATGGAGCTGGTGGAGAAGAA | Backbone Size:0; Vector Backbone:pLKO.1-puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:00 | 5 | |
|
pcDNA-FLAG-Mo-Trip6 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27254 | Trip6 | Mus musculus | Ampicillin | PMID:10395914 | Trip6 cDNA starts at aa 2. | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:01 | 1 | |
|
pAMPK alpha1 full length Resource Report Resource Website 1+ mentions |
RRID:Addgene_27297 | AMPK alpha1 | Mus musculus | Ampicillin | Backbone Marker:Invitrogen; Backbone Size:5600; Vector Backbone:pcDNA3.1/Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:01 | 4 | |||
|
pcDNA3/mPax3-3xHA Resource Report Resource Website 1+ mentions |
RRID:Addgene_27319 | Pax3 | Mus musculus | Ampicillin | PMID:7744814 | Backbone Size:5600; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:01 | 2 | ||
|
pSport6/FLAG-Wwtr1(Taz) Resource Report Resource Website 1+ mentions |
RRID:Addgene_27318 | Taz | Mus musculus | Ampicillin | Backbone Size:5800; Vector Backbone:pEF-BOS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:02 | 2 | |||
|
pcDNA3.1 AKT3 HA (CT-gfp) Resource Report Resource Website 1+ mentions |
RRID:Addgene_27293 | protein kinase B gamma | Mus musculus | Ampicillin | The GFP is not expressed as there is a stop codon after the HA tag. mTORC2 reportedly can phosphorylate FSY and FSF sites, so the Y473F mutation should not affect expression or function. | Backbone Marker:Invitrogen; Backbone Size:6157; Vector Backbone:pcDNA3.1/CT-GFP-Topo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Y473F | 2026-08-15 01:13:01 | 2 | |
|
pDONR221 - myc ULK1 wt Resource Report Resource Website |
RRID:Addgene_27623 | mouse myc ULK1 | Mus musculus | Kanamycin | PMID:21205641 | Backbone Size:4762; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | Initial M from ULK1 removed. Silent mutation at Arginine 5. Does not affect amino acid sequence. | 2026-08-15 01:13:05 | 0 | |
|
pDONR221 - myc ULK1 k46I Resource Report Resource Website |
RRID:Addgene_27624 | mouse myc ULK1 K46I | Mus musculus | Kanamycin | PMID:21205641 | Backbone Size:4762; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | Initial M from ULK1 removed. Silent mutation at Arginine 5. Does not affect amino acid sequence.K46I mutation makes protein catalytically inactive. | 2026-08-15 01:13:05 | 0 | |
|
cavin-1-mEGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_27709 | cavin-1 | Mus musculus | Ampicillin | PMID:20070607 | Backbone Marker:Invitrogen; Backbone Size:5069; Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:06 | 6 | ||
|
Abp1-tDimerRFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_27699 | Abp1 | Mus musculus | Kanamycin | PMID:21445324 | Cloned from IMAGE clone: 4986658 (MGC:51371). Cloned using Gateway acceptance vectors. | Backbone Marker:Clontech; Backbone Size:5400; Vector Backbone:pEGFP-N1 (EGFP replaced with tDimer-RFP); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:06 | 2 | |
|
GAK-pmCherryN1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27695 | GAK | Mus musculus | Kanamycin | PMID:21445324 | Cloned from IMAGE clone: 5705695 (MGC:86144). | Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:05 | 3 | |
|
Amph1-pmCherryN1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27692 | Amphiphysin 1 | Mus musculus | Kanamycin | PMID:21445324 | Cloned from IMAGE clone: 5686478 (MGC:64773). | Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:05 | 5 | |
|
BIN1-pmCherryN1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27693 | BIN1 | Mus musculus | Kanamycin | PMID:21445324 | Cloned from IMAGE clone: 5718309 (MGC:90098). | Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:06 | 2 | |
|
pcdna6.2- myc ULK1 wt Resource Report Resource Website 1+ mentions |
RRID:Addgene_27629 | mouse myc ULK1 | Mus musculus | Ampicillin | PMID:21205641 | C-term V5 not expressed because of stop codon at end of ULK1. | Backbone Size:7341; Vector Backbone:pcDNA 6.2 V5 dest (Invitrogen); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Initial M from ULK1 removed. Silent mutation at Arginine 5. Does not affect amino acid sequence. | 2026-08-15 01:13:05 | 5 |
|
pQCXIN- myc ULK1 K46I Resource Report Resource Website |
RRID:Addgene_27627 | mouse myc ULK1 K46I | Mus musculus | Ampicillin | PMID:21205641 | Backbone Marker:Addgene plasmid 17399; Backbone Size:9135; Vector Backbone:pQCXIN Neo dest; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | Initial M from ULK1 removed. Silent mutation at Arginine 5. Does not affect amino acid sequence.K46I mutation makes kinase catalytically inactive. | 2026-08-15 01:13:05 | 0 | |
|
pQCXIN- myc ULK1 4SA Resource Report Resource Website 1+ mentions |
RRID:Addgene_27628 | mouse myc ULK1 4SA | Mus musculus | Ampicillin | PMID:21205641 | Backbone Marker:Addgene plasmid 17399; Backbone Size:9135; Vector Backbone:pQCXIN Neo dest; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | S467A, S555A, T574A, S637A. Initial M from ULK1 removed. Silent mutation at Arginine 5, which does not affect amino acid sequence. | 2026-08-15 01:13:04 | 1 | |
|
pDONR221 - myc ULK1 4SA Resource Report Resource Website |
RRID:Addgene_27625 | mouse myc ULK1 4SA | Mus musculus | Kanamycin | PMID:21205641 | Backbone Size:4762; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | S467A, S555A, T574A, S637A. Initial M from ULK1 removed. Silent mutation at Arginine 5, which does not affect amino acid sequence. | 2026-08-15 01:13:04 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.