Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Organism:mus musculus (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

12,959 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
p3xFLAG-CMV-Tlr4(Lps)
 
Resource Report
Resource Website
RRID:Addgene_27149 toll-like receptor 4(Lps) Mus musculus Ampicillin PMID:9851930 Backbone Marker:Sigma; Backbone Size:4732; Vector Backbone:p3xFLAG-CMV-8; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin changed Proline 712 to Histidine. Native signal peptide sequence (original amino acids 1-24) was removed for cloning. 2026-08-15 01:13:00 0
pRK5-Flag-HA-Merlin
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_27104 Merlin Mus musculus Ampicillin PMID:20178741 Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:59 1
pRK5-Merlin-Flag-HA
 
Resource Report
Resource Website
RRID:Addgene_27103 Merlin Mus musculus Ampicillin PMID:20178741 Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:59 0
pLKO.1-MKL1/2 shRNA
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_27161 shRNA MKL1+2 Mus musculus Ampicillin PMID:20466732 shRNA sequence for knockdown of both MKL1 and MKL2: CATGGAGCTGGTGGAGAAGAA Backbone Size:0; Vector Backbone:pLKO.1-puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:13:00 5
pcDNA-FLAG-Mo-Trip6
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_27254 Trip6 Mus musculus Ampicillin PMID:10395914 Trip6 cDNA starts at aa 2. Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:01 1
pAMPK alpha1 full length
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_27297 AMPK alpha1 Mus musculus Ampicillin Backbone Marker:Invitrogen; Backbone Size:5600; Vector Backbone:pcDNA3.1/Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:01 4
pcDNA3/mPax3-3xHA
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_27319 Pax3 Mus musculus Ampicillin PMID:7744814 Backbone Size:5600; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:01 2
pSport6/FLAG-Wwtr1(Taz)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_27318 Taz Mus musculus Ampicillin Backbone Size:5800; Vector Backbone:pEF-BOS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:02 2
pcDNA3.1 AKT3 HA (CT-gfp)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_27293 protein kinase B gamma Mus musculus Ampicillin The GFP is not expressed as there is a stop codon after the HA tag. mTORC2 reportedly can phosphorylate FSY and FSF sites, so the Y473F mutation should not affect expression or function. Backbone Marker:Invitrogen; Backbone Size:6157; Vector Backbone:pcDNA3.1/CT-GFP-Topo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Y473F 2026-08-15 01:13:01 2
pDONR221 - myc ULK1 wt
 
Resource Report
Resource Website
RRID:Addgene_27623 mouse myc ULK1 Mus musculus Kanamycin PMID:21205641 Backbone Size:4762; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin Initial M from ULK1 removed. Silent mutation at Arginine 5. Does not affect amino acid sequence. 2026-08-15 01:13:05 0
pDONR221 - myc ULK1 k46I
 
Resource Report
Resource Website
RRID:Addgene_27624 mouse myc ULK1 K46I Mus musculus Kanamycin PMID:21205641 Backbone Size:4762; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin Initial M from ULK1 removed. Silent mutation at Arginine 5. Does not affect amino acid sequence.K46I mutation makes protein catalytically inactive. 2026-08-15 01:13:05 0
cavin-1-mEGFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_27709 cavin-1 Mus musculus Ampicillin PMID:20070607 Backbone Marker:Invitrogen; Backbone Size:5069; Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:06 6
Abp1-tDimerRFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_27699 Abp1 Mus musculus Kanamycin PMID:21445324 Cloned from IMAGE clone: 4986658 (MGC:51371). Cloned using Gateway acceptance vectors. Backbone Marker:Clontech; Backbone Size:5400; Vector Backbone:pEGFP-N1 (EGFP replaced with tDimer-RFP); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:13:06 2
GAK-pmCherryN1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_27695 GAK Mus musculus Kanamycin PMID:21445324 Cloned from IMAGE clone: 5705695 (MGC:86144). Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:13:05 3
Amph1-pmCherryN1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_27692 Amphiphysin 1 Mus musculus Kanamycin PMID:21445324 Cloned from IMAGE clone: 5686478 (MGC:64773). Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:13:05 5
BIN1-pmCherryN1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_27693 BIN1 Mus musculus Kanamycin PMID:21445324 Cloned from IMAGE clone: 5718309 (MGC:90098). Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:13:06 2
pcdna6.2- myc ULK1 wt
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_27629 mouse myc ULK1 Mus musculus Ampicillin PMID:21205641 C-term V5 not expressed because of stop codon at end of ULK1. Backbone Size:7341; Vector Backbone:pcDNA 6.2
 V5
 dest
 (Invitrogen); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Initial M from ULK1 removed. Silent mutation at Arginine 5. Does not affect amino acid sequence. 2026-08-15 01:13:05 5
pQCXIN- myc ULK1 K46I
 
Resource Report
Resource Website
RRID:Addgene_27627 mouse myc ULK1 K46I Mus musculus Ampicillin PMID:21205641 Backbone Marker:Addgene plasmid 17399; Backbone Size:9135; Vector Backbone:pQCXIN Neo dest; Vector Types:Retroviral; Bacterial Resistance:Ampicillin Initial M from ULK1 removed. Silent mutation at Arginine 5. Does not affect amino acid sequence.K46I mutation makes kinase catalytically inactive. 2026-08-15 01:13:05 0
pQCXIN- myc ULK1 4SA
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_27628 mouse myc ULK1 4SA Mus musculus Ampicillin PMID:21205641 Backbone Marker:Addgene plasmid 17399; Backbone Size:9135; Vector Backbone:pQCXIN Neo dest; Vector Types:Retroviral; Bacterial Resistance:Ampicillin S467A, S555A, T574A, S637A. Initial M from ULK1 removed. Silent mutation at Arginine 5, which does not affect amino acid sequence. 2026-08-15 01:13:04 1
pDONR221 - myc ULK1 4SA
 
Resource Report
Resource Website
RRID:Addgene_27625 mouse myc ULK1 4SA Mus musculus Kanamycin PMID:21205641 Backbone Size:4762; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin S467A, S555A, T574A, S637A. Initial M from ULK1 removed. Silent mutation at Arginine 5, which does not affect amino acid sequence. 2026-08-15 01:13:04 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.