Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: toll-like receptor 4(Lps)
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:4732; Vector Backbone:p3xFLAG-CMV-8; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9851930
Proper citation: RRID:Addgene_27149 Copy
Species: Mus musculus
Genetic Insert: Merlin
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20178741
Proper citation: RRID:Addgene_27104 Copy
Species: Mus musculus
Genetic Insert: Merlin
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20178741
Proper citation: RRID:Addgene_27103 Copy
Species: Mus musculus
Genetic Insert: shRNA MKL1+2
Vector Backbone Description: Backbone Size:0; Vector Backbone:pLKO.1-puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20466732
Comments: shRNA sequence for knockdown of both MKL1 and MKL2: CATGGAGCTGGTGGAGAAGAA
Proper citation: RRID:Addgene_27161 Copy
Species: Mus musculus
Genetic Insert: Trip6
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10395914
Comments: Trip6 cDNA starts at aa 2.
Proper citation: RRID:Addgene_27254 Copy
Species: Mus musculus
Genetic Insert: AMPK alpha1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5600; Vector Backbone:pcDNA3.1/Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_27297 Copy
Species: Mus musculus
Genetic Insert: Pax3
Vector Backbone Description: Backbone Size:5600; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7744814
Proper citation: RRID:Addgene_27319 Copy
Species: Mus musculus
Genetic Insert: Taz
Vector Backbone Description: Backbone Size:5800; Vector Backbone:pEF-BOS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_27318 Copy
Species: Mus musculus
Genetic Insert: protein kinase B gamma
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6157; Vector Backbone:pcDNA3.1/CT-GFP-Topo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: The GFP is not expressed as there is a stop codon after the HA tag.
mTORC2 reportedly can phosphorylate FSY and FSF sites, so the Y473F mutation should not affect expression or function.
Proper citation: RRID:Addgene_27293 Copy
Species: Mus musculus
Genetic Insert: mouse myc ULK1
Vector Backbone Description: Backbone Size:4762; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21205641
Proper citation: RRID:Addgene_27623 Copy
Species: Mus musculus
Genetic Insert: mouse myc ULK1 K46I
Vector Backbone Description: Backbone Size:4762; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21205641
Proper citation: RRID:Addgene_27624 Copy
Species: Mus musculus
Genetic Insert: cavin-1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5069; Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20070607
Proper citation: RRID:Addgene_27709 Copy
Species: Mus musculus
Genetic Insert: Abp1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5400; Vector Backbone:pEGFP-N1 (EGFP replaced with tDimer-RFP); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Comments: Cloned from IMAGE clone: 4986658 (MGC:51371).
Cloned using Gateway acceptance vectors.
Proper citation: RRID:Addgene_27699 Copy
Species: Mus musculus
Genetic Insert: GAK
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Comments: Cloned from IMAGE clone: 5705695 (MGC:86144).
Proper citation: RRID:Addgene_27695 Copy
Species: Mus musculus
Genetic Insert: Amphiphysin 1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Comments: Cloned from IMAGE clone: 5686478 (MGC:64773).
Proper citation: RRID:Addgene_27692 Copy
Species: Mus musculus
Genetic Insert: BIN1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Comments: Cloned from IMAGE clone: 5718309 (MGC:90098).
Proper citation: RRID:Addgene_27693 Copy
Species: Mus musculus
Genetic Insert: mouse myc ULK1
Vector Backbone Description: Backbone Size:7341; Vector Backbone:pcDNA 6.2
V5
dest
(Invitrogen); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21205641
Comments: C-term V5 not expressed because of stop codon at end of ULK1.
Proper citation: RRID:Addgene_27629 Copy
Species: Mus musculus
Genetic Insert: mouse myc ULK1 K46I
Vector Backbone Description: Backbone Marker:Addgene plasmid 17399; Backbone Size:9135; Vector Backbone:pQCXIN Neo dest; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21205641
Proper citation: RRID:Addgene_27627 Copy
Species: Mus musculus
Genetic Insert: mouse myc ULK1 4SA
Vector Backbone Description: Backbone Marker:Addgene plasmid 17399; Backbone Size:9135; Vector Backbone:pQCXIN Neo dest; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21205641
Proper citation: RRID:Addgene_27628 Copy
Species: Mus musculus
Genetic Insert: mouse myc ULK1 4SA
Vector Backbone Description: Backbone Size:4762; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21205641
Proper citation: RRID:Addgene_27625 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
