Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:ampicillin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

328,630 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pCri-18a
 
Resource Report
Resource Website 		RRID:Addgene_61326 Green fluorescent protein Ampicillin PMID:25386923 Vector Backbone:pHT-43; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:41 0
pCri-12a
 
Resource Report
Resource Website 		RRID:Addgene_61320 Green fluorescent protein Ampicillin PMID:25386923 Vector Backbone:pRBI-DsbC; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:41 0
pERB221
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61502 CenpB-GFP-Halo Homo sapiens Ampicillin PMID:25400104 Backbone Marker:Dr. Eugene Makeyev; Vector Backbone:pEM791; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:42 2
pERB217
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61500 HaloTag-GFP-Mito Homo sapiens Ampicillin PMID:25400104 Backbone Marker:Dr. Eugene Makeyev; Vector Backbone:pEM791; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:43 2
pERB219
 
Resource Report
Resource Website 		RRID:Addgene_61501 HaloTag-GFP-PACT Homo sapiens Ampicillin PMID:25400104 Backbone Marker:Dr. Eugene Makeyev; Vector Backbone:pEM791; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:42 0
Mito-ABKAR
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61509 AMPK Biosensor Ampicillin PMID:25892241 Mitochondrial targeting signal (DAKAP1-30): ATGGCAATCCAGTTGCGTTCGCTCTTCCCCTTGGCGTTGCCCGGAATGCTGGCCCTCCTTGGCTGGTGGTGGTTTTTCTCTCGTAAAAAA Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:43 1
FUGW-PK-hLC3∆G
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61461 PK-hLC3∆G Homo sapiens Ampicillin PMID:25340751 We thank Dr. James Edward Rothman for providing respective pHluorin. Backbone Size:9000; Vector Backbone:FUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:17:42 4
pAAV-CWB-EGFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61462 EGFP Ampicillin PMID:24618276 Backbone Size:4159; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:17:42 2
px335 Mettl14 sgRNA #2
 
Resource Report
Resource Website 		RRID:Addgene_61514 gccgctcccggatctcctgc Mus musculus Ampicillin PMID:25569111 Vector Backbone:px335; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:17:43 0
pBRPyCAG-Mettl3-dsRed-IRES-puro
 
Resource Report
Resource Website 		RRID:Addgene_61516 Mettl3 Mus musculus Ampicillin PMID:25569111 Vector Backbone:pBRPy; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:43 0
pChimera
 
Resource Report
Resource Website 		RRID:Addgene_61476 U6-26:sgRNA Arabidopsis thaliana Ampicillin PMID:24836556 Backbone Marker:GeneArt; Backbone Size:2400; Vector Backbone:pMA-T; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:17:42 0
pEn-C1.1
 
Resource Report
Resource Website 		RRID:Addgene_61479 AtU6-26:sgRNA Arabidopsis thaliana Ampicillin PMID:25327456 Based on pEn-Chimera; MluI and Bsu36I RS added to each side of the U6-26:sgRNA sequence for cloning of up to 3 sgRNAs into Cas9 expression vector. Backbone Marker:Promega Corp.; Backbone Size:3000; Vector Backbone:pGEM-T-easy; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:17:42 0
pLV_TRET_hNgn1_UBC_Bla
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61473 Ngn1 Homo sapiens Ampicillin PMID:25403753 Backbone Marker:Lab of David Baltimore; Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:17:42 2
pLV_TRET_Ngn2‐2A‐Ngn1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61471 Ngn2 Mus musculus Ampicillin PMID:25403753 Backbone Marker:Lab of David Baltimore; Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:17:43 2
miR-144-451 Trap
 
Resource Report
Resource Website 		RRID:Addgene_61488 miR-144-451 Trap Ampicillin PMID:25312678 Backbone Marker:Naldinin lab, Brown, et al. 2007 PMID 18026085; Vector Backbone:biPGK; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:17:42 0
RAB14 3'UTR WT
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61489 RAB14 3' UTR Homo sapiens Ampicillin PMID:25312678 Backbone Marker:Promega; Backbone Size:7350; Vector Backbone:pmirGLO Dual-Luciferase; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin contains position 837-1637 (numbering relative to start of 3'utr) 2026-08-15 01:17:42 1
TetO-FUW-Hes3
 
Resource Report
Resource Website 		RRID:Addgene_61535 Hes3 Mus musculus Ampicillin PMID:25454632 Backbone Size:8376; Vector Backbone:TetO-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:17:43 0
TetO-FUW-MEF2CA
 
Resource Report
Resource Website 		RRID:Addgene_61538 MEF2CA Homo sapiens Ampicillin PMID:25454632 Backbone Size:8376; Vector Backbone:TetO-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:17:43 0
pERB215
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61499 HaloTag-GFP-Nuf2 Homo sapiens Ampicillin PMID:25400104 Backbone Marker:Dr. Eugene Makeyev; Vector Backbone:pEM791; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:42 1
TetO-FUW-Bmi1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61532 Bmi1 Mus musculus Ampicillin PMID:25454632 Backbone Size:8376; Vector Backbone:TetO-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:17:43 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch