Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Cortactin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Comments: Adapted from Natalie Soulet Cortactin-pEGFP-C1 construct.
Proper citation: RRID:Addgene_27676 Copy
Species: Mus musculus
Genetic Insert: OCRL1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Comments: Cloned from IMAGE clone: 30533468 (MGC:93022).
Proper citation: RRID:Addgene_27675 Copy
Species: Mus musculus
Genetic Insert: Cofilin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Comments: Gene PCR from cDNA library from mouse brain
Proper citation: RRID:Addgene_27687 Copy
Species: Mus musculus
Genetic Insert: CIP4
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Comments: Cloned from IMAGE clone: 3500118 (MGC:6673).
Proper citation: RRID:Addgene_27685 Copy
Species: Mus musculus
Genetic Insert: Ack1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Comments: Cloned from IMAGE clone: 6400209 (MGC:63428).
Proper citation: RRID:Addgene_27684 Copy
Species: Mus musculus
Genetic Insert: Clathrin Light Chain
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Comments: Cloned from IMAGE clone: 3154277 (MGC:68133).
Proper citation: RRID:Addgene_27680 Copy
Species: Mus musculus
Genetic Insert: Egr2
Vector Backbone Description: Backbone Marker:A.Q. Bakker; Backbone Size:12443; Vector Backbone:LZRSpBMN-linker-IRES-EGFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_27784 Copy
Species: Mus musculus
Genetic Insert: 5.2 kB VEGF
Vector Backbone Description: Backbone Size:5598; Vector Backbone:PGL2 Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15582599
Proper citation: RRID:Addgene_27987 Copy
Species: Mus musculus
Genetic Insert: IL6
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17606866
Proper citation: RRID:Addgene_28088 Copy
Species: Mus musculus
Genetic Insert: Nr5a1 shRNA
Vector Backbone Description: Backbone Marker:Genscript; Backbone Size:6478; Vector Backbone:pRNAT-CMV3.1/Neo; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18388192
Comments: shRNA #3 sequence: GATCCTCAATGAGAAGGTTGTTGCGGTTGATATCCGCCGCAACAACCTTCTCATTGACGC
Proper citation: RRID:Addgene_28188 Copy
Species: Mus musculus
Genetic Insert: Adcy4 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5000; Vector Backbone:pGL3-basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12239114
Comments: Contains a total of ~1812 bp of genomic DNA--i.e.,1459 bp upstream of the Adcy4 transcription start site and 353 bp downstream of the transcription start site. The downstream DNA includes exon I, intron I and the non-coding portion of exon II.
Proper citation: RRID:Addgene_28184 Copy
Species: Mus musculus
Genetic Insert: Prkar1a
Vector Backbone Description: Backbone Size:7600; Vector Backbone:pMT-REV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8388994
Comments: Expression vector encoding dominant-negative regulatory subunit of type 1 cAMP-dependent protein kinase.
pMT-REV is a zinc-inducible expression vector driven by the metallothionein promoter.
Proper citation: RRID:Addgene_28179 Copy
Species: Mus musculus
Genetic Insert: Oct4, Sox2, Klf4, c-Myc, Lin28
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:10200; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21243013
Comments: Please note that Addgene's sequencing results using the CMV-F and pCEP-F primers found 2 sequence variants within and after the CMV enhancer. One is a C->G mismatch at position 775 within the CMV enhancer and the second is a deletion at position 949 just after the end of the CAG enhancer, as compared to the full plasmid sequence provided by the depositing scientist. The significance of the two sequence variants is unclear; however, the plasmid functions as described in the associated publication. Addgene's other 4 sequencing results completely matched the depositor's sequence.
Proper citation: RRID:Addgene_28213 Copy
Species: Mus musculus
Genetic Insert: NHERF1
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pCMV-2-FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17242191
Proper citation: RRID:Addgene_28297 Copy
Species: Mus musculus
Genetic Insert: Doublecortin 3' Untranslated region
Vector Backbone Description: Backbone Marker:University of Michigan; Backbone Size:4143; Vector Backbone:mU6pro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14625554
Comments: DCX 3’UTR hairpin siRNA sequence:
5’-GCUCAAGUGACCAACAAGGCUAUAGACACAAUAGCCUUGUUGGUCACUUGAGC-3’
Proper citation: RRID:Addgene_28301 Copy
Species: Mus musculus
Genetic Insert: Doublecortin 3' Untranslated region mutated
Vector Backbone Description: Backbone Marker:University of Michigan; Backbone Size:4143; Vector Backbone:mU6pro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14625554
Comments: DCX 3’UTRm3 mutation hairpin siRNA sequence:
5’-GCUCAAGUCACGAAGAAGGCUAUAGACACAAUAGCCUUCUUCGUGACUUGAGC-3’
Proper citation: RRID:Addgene_28302 Copy
Species: Mus musculus
Genetic Insert: Net1
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pEF-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19586902
Proper citation: RRID:Addgene_28264 Copy
Species: Mus musculus
Genetic Insert: Net1
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:5006; Vector Backbone:pGEX-KG; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19586902
Comments: Contains wt mNet1 (aa 1-595)
Proper citation: RRID:Addgene_28260 Copy
Species: Mus musculus
Genetic Insert: GADD34
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11381086
Comments: The construct was created by recovering the Sma1 fragment of mMyD116 and ligating it into the unique SnB1 site of pBABEpu. The stop codo is deep in the downstream SV40 promoter sequence andowing the encoded poly-peptide with a tail of nonesense sequence, but it does serve as an expressed negative control for the effects of GADD34.
Proper citation: RRID:Addgene_21835 Copy
Species: Mus musculus
Genetic Insert: GADD34
Vector Backbone Description: Backbone Size:4724; Vector Backbone:pCMV2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11381086
Proper citation: RRID:Addgene_21834 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
