Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: EGFP
Vector Backbone Description: Backbone Marker:Karl Deisseroth; Backbone Size:2890; Vector Backbone:pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31242442
Proper citation: RRID:Addgene_102936 Copy
Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Backbone Marker:Bornkamm , et al. PMID 16147984; Vector Backbone:prTS; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28448738
Proper citation: RRID:Addgene_102934 Copy
Species: Synthetic
Genetic Insert: ABE7.9
Vector Backbone Description: Backbone Marker:Liu lab; Backbone Size:3388; Vector Backbone:pBR322/CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29160308
Proper citation: RRID:Addgene_102918 Copy
Species: Synthetic
Genetic Insert: ABE7.10
Vector Backbone Description: Backbone Marker:Liu lab; Backbone Size:3388; Vector Backbone:pBR322/CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29160308
Proper citation: RRID:Addgene_102919 Copy
Species: Synthetic
Genetic Insert: ABE6.3
Vector Backbone Description: Backbone Marker:Liu lab; Backbone Size:3388; Vector Backbone:pBR322/CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29160308
Proper citation: RRID:Addgene_102916 Copy
Species: Synthetic
Genetic Insert: dSpCas9, pdDronpa1.2
Vector Backbone Description: Backbone Marker:System Biosciences; Vector Backbone:pPB; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28938067
Proper citation: RRID:Addgene_102855 Copy
Species: Synthetic
Genetic Insert: Synthetic construct isolate AAV-PHP.B2 VP1 gene
Vector Backbone Description: Vector Backbone:pUC57-mini; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26829320
Comments: Please note that this is a non-standard rep-cap construct. It uses a tTA-TRE amplification loop to increase Capsid expression and AAV production. We find that this system increases AAV titers 1.5-5 fold (Ben Deverman, Bryan Simpson and Paul Patterson, unpublished data). This is a tet-off system, so no dox or tet is needed to turn it on. It can be used like any other rep-cap plasmid. *This system should only present a problem if the rAAV genome to be packaged has a tet responsive element that directs expression of a protein that affected the health of the production cells. The introduction of an XbaI restriction site for ease of cloning introduces a K449R mutation, which does not have an overt effect on vector production or transduction.
Proper citation: RRID:Addgene_103003 Copy
Species: Synthetic
Genetic Insert: Synthetic construct isolate AAV-PHP.B VP1 gene
Vector Backbone Description: Vector Backbone:pUC57-mini; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26829320
Comments: Please note that this is a non-standard rep-cap construct. It uses a tTA-TRE amplification loop to increase Capsid expression and AAV production. We find that this system increases AAV titers 1.5-5 fold (Ben Deverman, Bryan Simpson and Paul Patterson, unpublished data). This is a tet-off system, so no dox or tet is needed to turn it on. It can be used like any other rep-cap plasmid. *This system should only present a problem if the rAAV genome to be packaged has a tet responsive element that directs expression of a protein that affected the health of the production cells. The introduction of an XbaI restriction site for ease of cloning introduces a K449R mutation, which does not have an overt effect on vector production or transduction.
Proper citation: RRID:Addgene_103002 Copy
Species: Synthetic
Genetic Insert: Synthetic construct isolate AAV-PHP.eB VP1 gene
Vector Backbone Description: Vector Backbone:pUC57-mini; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28671695
Comments: Please note that this is a non-standard rep-cap construct. It uses a tTA-TRE amplification loop to increase Capsid expression and AAV production. We find that this system increases AAV titers 1.5-5 fold (Ben Deverman, Bryan Simpson and Paul Patterson, unpublished data). This is a tet-off system, so no dox or tet is needed to turn it on. It can be used like any other rep-cap plasmid. This system should only present a problem if the rAAV genome to be packaged has a tet responsive element that directs expression of a protein that affected the health of the production cells. The introduction of an XbaI restriction site for ease of cloning introduces a K449R mutation, which does not have an overt effect on vector production or transduction.
Proper citation: RRID:Addgene_103005 Copy
Species: Synthetic
Genetic Insert: Synthetic construct isolate AAV-PHP.B3 VP1 gene
Vector Backbone Description: Vector Backbone:pUC57-mini; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26829320
Comments: Please note that this is a non-standard rep-cap construct. It uses a tTA-TRE amplification loop to increase Capsid expression and AAV production. We find that this system increases AAV titers 1.5-5 fold (Ben Deverman, Bryan Simpson and Paul Patterson, unpublished data). This is a tet-off system, so no dox or tet is needed to turn it on. It can be used like any other rep-cap plasmid. *This system should only present a problem if the rAAV genome to be packaged has a tet responsive element that directs expression of a protein that affected the health of the production cells. The introduction of an XbaI restriction site for ease of cloning introduces a K449R mutation, which does not have an overt effect on vector production or transduction.
Proper citation: RRID:Addgene_103004 Copy
Species: Synthetic
Genetic Insert: TIMER-bac
Vector Backbone Description: Backbone Size:9262; Vector Backbone:pSC101; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25126781
Comments: TIMER-bac was generated by exchanging TCC coding for serine 197 to ACC coding for threonine in DsRed.T3_S4T (Sörensen et al., 2003). PybaJ-Timer-bac was cloned into pUA66 with a pSC101 replicon, conferring kanamycin resistance.
Proper citation: RRID:Addgene_103057 Copy
Species: Synthetic
Genetic Insert: human codon optimized AsCas12a with NLS(nucleoplasmin)-3xHA-P2A-EGFP
Vector Backbone Description: Vector Backbone:JDS246 (Plasmid #43861); Vector Types:Mammalian Expression, in vitro transcription; T7 promoter; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33547443
Proper citation: RRID:Addgene_160140 Copy
Species: Synthetic
Genetic Insert: eGFP
Vector Backbone Description: Vector Backbone:pLenti6.2 backbone; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32371478
Proper citation: RRID:Addgene_160111 Copy
Species: Synthetic
Genetic Insert: eGFP
Vector Backbone Description: Vector Backbone:pLX304 backbone; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32371478
Proper citation: RRID:Addgene_160095 Copy
Species: Synthetic
Genetic Insert: Plasmid library harboring a randomized 10nt PAM 5’ of target site 3
Vector Backbone Description: Vector Backbone:p11-LacY-wtx1 (Addgene plasmid #69056); Vector Types:CRISPR, Substrate for -Cas enzymes; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33547443
Proper citation: RRID:Addgene_160134 Copy
Species: Synthetic
Genetic Insert: SpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
Vector Backbone Description: Vector Backbone:DR274 (Addgene plasmid #42250); Vector Types:in vitro transcription of sgRNA from T7 promoter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33547443
Proper citation: RRID:Addgene_160136 Copy
Species: Synthetic
Genetic Insert: SpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
Vector Backbone Description: Vector Backbone:DR274 (Addgene plasmid #42250); Vector Types:in vitro transcription of sgRNA from T7 promoter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33547443
Proper citation: RRID:Addgene_160137 Copy
Species: Synthetic
Genetic Insert: AsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
Vector Backbone Description: Vector Backbone:DR274 (Addgene plasmid #42250); Vector Types:in vitro transcription of sgRNA from T7 promoter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33547443
Proper citation: RRID:Addgene_160138 Copy
Species: Synthetic
Genetic Insert: His-redFAST
Vector Backbone Description: Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32778846
Proper citation: RRID:Addgene_160350 Copy
Species: Synthetic
Genetic Insert: lyn11-greenFAST
Vector Backbone Description: Vector Backbone:pIRES; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32778846
Proper citation: RRID:Addgene_160352 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.