Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pOTTC385 - pAAV CMV-IE IRES EGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_102936 | EGFP | Synthetic | Ampicillin | PMID:31242442 | Backbone Marker:Karl Deisseroth; Backbone Size:2890; Vector Backbone:pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:27 | 2 | ||
|
pRTS-GBP-dCas9-mRFP Resource Report Resource Website |
RRID:Addgene_102934 | dCas9 | Synthetic | Ampicillin | PMID:28448738 | Backbone Marker:Bornkamm , et al. PMID 16147984; Vector Backbone:prTS; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:27 | 0 | ||
|
pCMV-ABE7.9 Resource Report Resource Website 1+ mentions |
RRID:Addgene_102918 | ABE7.9 | Synthetic | Ampicillin | PMID:29160308 | Backbone Marker:Liu lab; Backbone Size:3388; Vector Backbone:pBR322/CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | see manuscript | 2026-08-15 01:00:27 | 3 | |
|
pCMV-ABE7.10 Resource Report Resource Website 10+ mentions |
RRID:Addgene_102919 | ABE7.10 | Synthetic | Ampicillin | PMID:29160308 | Backbone Marker:Liu lab; Backbone Size:3388; Vector Backbone:pBR322/CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | see manuscript | 2026-08-15 01:00:27 | 40 | |
|
pCMV-ABE6.3 Resource Report Resource Website |
RRID:Addgene_102916 | ABE6.3 | Synthetic | Ampicillin | PMID:29160308 | Backbone Marker:Liu lab; Backbone Size:3388; Vector Backbone:pBR322/CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | see manuscript | 2026-08-15 01:00:27 | 0 | |
|
VPR-ps-dSpCas9 Resource Report Resource Website |
RRID:Addgene_102855 | dSpCas9, pdDronpa1.2 | Synthetic | Ampicillin | PMID:28938067 | Backbone Marker:System Biosciences; Vector Backbone:pPB; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:26 | 0 | ||
|
pUCmini-iCAP-PHP.B2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_103003 | Synthetic construct isolate AAV-PHP.B2 VP1 gene | Synthetic | Ampicillin | PMID:26829320 | Please note that this is a non-standard rep-cap construct. It uses a tTA-TRE amplification loop to increase Capsid expression and AAV production. We find that this system increases AAV titers 1.5-5 fold (Ben Deverman, Bryan Simpson and Paul Patterson, unpublished data). This is a tet-off system, so no dox or tet is needed to turn it on. It can be used like any other rep-cap plasmid. *This system should only present a problem if the rAAV genome to be packaged has a tet responsive element that directs expression of a protein that affected the health of the production cells. The introduction of an XbaI restriction site for ease of cloning introduces a K449R mutation, which does not have an overt effect on vector production or transduction. | Vector Backbone:pUC57-mini; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:28 | 1 | |
|
pUCmini-iCAP-PHP.B Resource Report Resource Website 10+ mentions |
RRID:Addgene_103002 | Synthetic construct isolate AAV-PHP.B VP1 gene | Synthetic | Ampicillin | PMID:26829320 | Please note that this is a non-standard rep-cap construct. It uses a tTA-TRE amplification loop to increase Capsid expression and AAV production. We find that this system increases AAV titers 1.5-5 fold (Ben Deverman, Bryan Simpson and Paul Patterson, unpublished data). This is a tet-off system, so no dox or tet is needed to turn it on. It can be used like any other rep-cap plasmid. *This system should only present a problem if the rAAV genome to be packaged has a tet responsive element that directs expression of a protein that affected the health of the production cells. The introduction of an XbaI restriction site for ease of cloning introduces a K449R mutation, which does not have an overt effect on vector production or transduction. | Vector Backbone:pUC57-mini; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:28 | 14 | |
|
pUCmini-iCAP-PHP.eB Resource Report Resource Website 100+ mentions |
RRID:Addgene_103005 | Synthetic construct isolate AAV-PHP.eB VP1 gene | Synthetic | Ampicillin | PMID:28671695 | Please note that this is a non-standard rep-cap construct. It uses a tTA-TRE amplification loop to increase Capsid expression and AAV production. We find that this system increases AAV titers 1.5-5 fold (Ben Deverman, Bryan Simpson and Paul Patterson, unpublished data). This is a tet-off system, so no dox or tet is needed to turn it on. It can be used like any other rep-cap plasmid. This system should only present a problem if the rAAV genome to be packaged has a tet responsive element that directs expression of a protein that affected the health of the production cells. The introduction of an XbaI restriction site for ease of cloning introduces a K449R mutation, which does not have an overt effect on vector production or transduction. | Vector Backbone:pUC57-mini; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:28 | 135 | |
|
pUCmini-iCAP-PHP.B3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_103004 | Synthetic construct isolate AAV-PHP.B3 VP1 gene | Synthetic | Ampicillin | PMID:26829320 | Please note that this is a non-standard rep-cap construct. It uses a tTA-TRE amplification loop to increase Capsid expression and AAV production. We find that this system increases AAV titers 1.5-5 fold (Ben Deverman, Bryan Simpson and Paul Patterson, unpublished data). This is a tet-off system, so no dox or tet is needed to turn it on. It can be used like any other rep-cap plasmid. *This system should only present a problem if the rAAV genome to be packaged has a tet responsive element that directs expression of a protein that affected the health of the production cells. The introduction of an XbaI restriction site for ease of cloning introduces a K449R mutation, which does not have an overt effect on vector production or transduction. | Vector Backbone:pUC57-mini; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:28 | 1 | |
|
pSC101_TIMER Resource Report Resource Website 1+ mentions |
RRID:Addgene_103057 | TIMER-bac | Synthetic | Kanamycin | PMID:25126781 | TIMER-bac was generated by exchanging TCC coding for serine 197 to ACC coding for threonine in DsRed.T3_S4T (Sörensen et al., 2003). PybaJ-Timer-bac was cloned into pUA66 with a pSC101 replicon, conferring kanamycin resistance. | Backbone Size:9262; Vector Backbone:pSC101; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | mutations: S4T and S179T | 2026-08-15 01:00:29 | 4 |
|
pCMV-T7-AsCas12a-P2A-EGFP (RTW2861) Resource Report Resource Website 1+ mentions |
RRID:Addgene_160140 | human codon optimized AsCas12a with NLS(nucleoplasmin)-3xHA-P2A-EGFP | Synthetic | Ampicillin | PMID:33547443 | Vector Backbone:JDS246 (Plasmid #43861); Vector Types:Mammalian Expression, in vitro transcription; T7 promoter; Bacterial Resistance:Ampicillin | 2026-08-15 01:08:36 | 2 | ||
|
pLenti6.2_3xFLAG_V5_ eGFP_V5 Resource Report Resource Website |
RRID:Addgene_160111 | eGFP | Synthetic | Ampicillin | PMID:32371478 | Vector Backbone:pLenti6.2 backbone; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:08:38 | 0 | ||
|
pLX304_zeo_eGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_160095 | eGFP | Synthetic | Ampicillin | PMID:32371478 | Vector Backbone:pLX304 backbone; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:08:38 | 2 | ||
|
p11-5’_10xN_PAM-site3 (RTW572) Resource Report Resource Website |
RRID:Addgene_160134 | Plasmid library harboring a randomized 10nt PAM 5’ of target site 3 | Synthetic | Ampicillin | PMID:33547443 | Vector Backbone:p11-LacY-wtx1 (Addgene plasmid #69056); Vector Types:CRISPR, Substrate for -Cas enzymes; Bacterial Resistance:Ampicillin | 2026-08-15 01:08:39 | 0 | ||
|
pT7-SpCas9_sgRNA-site1 (RTW443) Resource Report Resource Website 1+ mentions |
RRID:Addgene_160136 | SpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG) | Synthetic | Kanamycin | PMID:33547443 | Vector Backbone:DR274 (Addgene plasmid #42250); Vector Types:in vitro transcription of sgRNA from T7 promoter; Bacterial Resistance:Kanamycin | 2026-08-15 01:08:36 | 2 | ||
|
pT7-SpCas9_sgRNA-site2 (RTW448) Resource Report Resource Website 1+ mentions |
RRID:Addgene_160137 | SpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT) | Synthetic | Kanamycin | PMID:33547443 | Vector Backbone:DR274 (Addgene plasmid #42250); Vector Types:in vitro transcription of sgRNA from T7 promoter; Bacterial Resistance:Kanamycin | 2026-08-15 01:08:39 | 1 | ||
|
pT7-AsCas12a_crRNA-site3 (RTW549) Resource Report Resource Website |
RRID:Addgene_160138 | AsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC) | Synthetic | Kanamycin | PMID:33547443 | Vector Backbone:DR274 (Addgene plasmid #42250); Vector Types:in vitro transcription of sgRNA from T7 promoter; Bacterial Resistance:Kanamycin | 2026-08-15 01:08:36 | 0 | ||
|
pAG308-His-redFAST Resource Report Resource Website |
RRID:Addgene_160350 | His-redFAST | Synthetic | Kanamycin | PMID:32778846 | Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:08:38 | 0 | ||
|
pAG361-lyn11-greenFAST Resource Report Resource Website |
RRID:Addgene_160352 | lyn11-greenFAST | Synthetic | Kanamycin | PMID:32778846 | Vector Backbone:pIRES; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:08:41 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.