Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Abr
Vector Backbone Description: Backbone Marker:Don Kohn [email protected]; Backbone Size:6600; Vector Backbone:pCCL-cppt178-MNDU3; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17116687
Comments: Constructed by Jess Cunnick. Abr was first subcloned into pEYFP-C1 Bgl II x KpnI as a 0.4 kb 5' BamHI/BstEII + 2.2 kb BstEII- KpnI fragment. The EYFP-Abr fusion was isolated as a 5' AgeI- 3' KpnI fragment and inserted into pCCL-cppt178-MNDU3-X3 digested with Xma I x Kpn I.
Proper citation: RRID:Addgene_38155 Copy
Species: Homo sapiens
Genetic Insert: ABR
Vector Backbone Description: Backbone Size:7400; Vector Backbone:pLEF; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18070886
Comments: Constructed by Suparna Mishra. Generated in a 3-way ligation consisting of 5' 0.4 kb BamHI/BstEII + 3' 2.2 kb BstEII/EcoRI ABR fragments into pLEF digested with BamHIxEcoRI. The ABR insert contains the natural TAG and 3' UT sequences.
Addgene sequencing found an E24G point mutation--this does not alter plasmid function.
Proper citation: RRID:Addgene_38157 Copy
Species: Homo sapiens
Genetic Insert: Bcr
Vector Backbone Description: Backbone Size:7400; Vector Backbone:pLEF; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14614449
Comments: Constructed by Anja Reichert. Generated in a 3-way ligation consisting of 5' 0.6 kb BamHI/SalI + 3' 3.5 kb SalI/XbaI BCR fragments into pLEF digested with BamHIxXbaI. The BCR insert contains the natural TAG and 3' UT sequences. At the 3' end there are polylinker sequences from pSK.
Proper citation: RRID:Addgene_38160 Copy
Species: Homo sapiens
Genetic Insert: Bcr/Abl P210
Vector Backbone Description: Backbone Marker:Pharmingen; Backbone Size:8530; Vector Backbone:pAcG2T; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: Constructed by Nora Heisterkamp. Made using a 3-way ligation with 0.6 kb 5' BamHI-SalI from BCR + 3' 7.5 kb Sal I-EcoRI into pAcG2T. Not evaluated for protein production.
Proper citation: RRID:Addgene_38161 Copy
Species: Caenorhabditis elegans
Genetic Insert: cbr-unc-119::FRT*::galk::FRT*
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KSII(+); Vector Types:Worm Expression, recombineering; Bacterial Resistance:Ampicillin
Comments: This plasmid carries a complementary cassette consisting of a genomic copy of the C. briggsae unc-119 gene and the selectable galK marker flanked by FRT* sites in the presumptive 3’ UTR of the Cbr-unc-119 gene.
The 3.6 kb Cbr-unc-119::FRT*::galk::FRT* cassette can be targeted by recombineering to insert between nts 281:282 in the pCC1FOS fosmid vector backbone. In other words, this cassette can be readily inserted in all fosmids contained in the C. elegans library developed by Don Moerman and colleagues. We have tested the construct in fosmid recombineering and have shown that it rescues unc-119(ed3) mutants.
Proper citation: RRID:Addgene_38149 Copy
Species: Caenorhabditis elegans
Genetic Insert: ptc-3::GFP
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KSII(+); Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21215260
Comments: The pPK348 plasmid was derived by inserting the GFP cassette from pPD103.87 (Addgene plasmid 1524) flanked by XbaI ends into the unique SpeI site present in exon 8 of ptc-3 and carries the entire predicted ptc-3 locus comprised of a 6.9 kb genomic coding region fused in-frame to GFP and more than 5 kb of 5′ upstream sequence, including the putative promoter
Please note that Addgene's sequencing results identified several mismatches in the region of bp#722-824 when compared to the full plasmid sequence provided by the depositing laboratory. The depositor states that these mismatches are not a concern for the function of the plasmid.
Proper citation: RRID:Addgene_38145 Copy
Species: Caenorhabditis elegans
Genetic Insert: let-60p::ptc-3::gfp
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KSII(+); Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21215260
Comments: The pPK700 plasmid was derived by ligating the let-60 promoter region to ptc-3::gfp expression cassette, which was PCR amplified from pPK348 (Addgene plasmid 38145)
Proper citation: RRID:Addgene_38146 Copy
Species: Synthetic
Genetic Insert: GoldyTALEN
Vector Backbone Description: Backbone Size:2900; Vector Backbone:pBSK; Vector Types:mRNA transcription vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23027955
Comments: Please note that this plasmid can be prone to recombination in bacteria. We recommend storing and propagating the construct in Stbl3 cells and screen 4-6 colonies by sequencing with TAL_F1 (ttggcgtcggcaaacagtgg) primer.
The F1 origin feature in the full plasmid sequence is in reverse compliment orientation. Please view Addgene's quality control sequence for the most accurate information. The flipped orientation does not affect the SacI site necessary to linearize the plasmid.
For further reference, this plasmid was also used in the Bedell et al Nature 2012 publication (PMID 23000899).
For more information on Carlson TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#carlson
Proper citation: RRID:Addgene_38142 Copy
Species: Synthetic
Genetic Insert: GoldyTALEN
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pBSK; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23027955
Comments: For further reference, this plasmid was also used in the Bedell et al Nature 2012 publication (PMID 23000899).
For more information on Carlson TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#carlson
Proper citation: RRID:Addgene_38143 Copy
Species: M. anisopliae
Genetic Insert: Carboxypeptidase A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6526; Vector Backbone:pFastBac-1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21073956
Proper citation: RRID:Addgene_38150 Copy
Species: Mus musculus
Genetic Insert: Jhdm2a
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pcDNA4/myc-His A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22722204
Proper citation: RRID:Addgene_38136 Copy
Species: Rattus norvegicus
Genetic Insert: 4EBP1
Vector Backbone Description: Backbone Marker:Broad Insitute; Backbone Size:5000; Vector Backbone:pCW57.1; Vector Types:Mammalian Expression, Lentiviral, Doxycycline inducible; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22552098
Proper citation: RRID:Addgene_38240 Copy
Species: Mus musculus
Genetic Insert: Vim promoter with Actb 5UTR/Renilla
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22552098
Comments: This vector originally contained the mouse Actb 5' UTR followed by the renilla luciferase ORF. In the current version, the promoter and first 30 nt of the 5' UTR have been replaced by the mouse Vim promoter and first 30 nt of the Vim 5' UTR, respectively.
Proper citation: RRID:Addgene_38238 Copy
Species: Homo sapiens
Genetic Insert: cIAP1 H588A
Vector Backbone Description: Backbone Marker:Baltimore Lab; Backbone Size:5350; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19243308
Proper citation: RRID:Addgene_38233 Copy
Species: Rattus norvegicus
Genetic Insert: microtubule-associated protein 1 light chain 3 beta
Vector Backbone Description: Backbone Marker:Dr. Toshio Kitamura of the University of Tokyo ; Backbone Size:5847; Vector Backbone:pMXs-IP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18443221
Proper citation: RRID:Addgene_38195 Copy
Species: Mus musculus
Genetic Insert: a novel protein kinase structurally related to C. elegans UNC-51
Vector Backbone Description: Backbone Marker:Dr. Toshio Kitamura of the University of Tokyo ; Backbone Size:5847; Vector Backbone:pMXs-IP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18443221
Proper citation: RRID:Addgene_38197 Copy
Species: Mus musculus
Genetic Insert: a novel protein kinase structurally related to C. elegans UNC-51
Vector Backbone Description: Backbone Marker:Dr. Toshio Kitamura of the University of Tokyo ; Backbone Size:5847; Vector Backbone:pMXs-IP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18443221
Proper citation: RRID:Addgene_38198 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: HIS3
Vector Backbone Description: Backbone Size:6614; Vector Backbone:pCENBEVY-U; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24357599
Proper citation: RRID:Addgene_38228 Copy
Species: Homo sapiens
Genetic Insert: BCR
Vector Backbone Description: Backbone Size:4805; Vector Backbone:pKH3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Constructed by Young Jin Cho.
A human BCR cDNA was inserted into pKH3 (Addgene plasmid #12555; obtained from Martin Schwartz) digested with BamHI x EcoRI in a three-way ligation (1.7 kb BamHI-SstI + 2.6 kb SstI-EcoRI). The 1.7 kb BamHI-SstI fragment was isolated from Bcr in pAcG2T (AddGene plasmid #38163). The 5’ sequence is
GGA TCC CCC GGG CTG CAG GAA TTC GAT GGC CGC GCC ATG-start BCR.
Proper citation: RRID:Addgene_38189 Copy
Species: Photinus pyralis
Genetic Insert: Firefly Luciferase
Vector Backbone Description: Backbone Size:7122; Vector Backbone:pCENBEVY-U; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24357599
Proper citation: RRID:Addgene_38223 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
