Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Other
Genetic Insert: ECFP
Vector Backbone Description: Vector Backbone:pQLinkHD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30339749
Proper citation: RRID:Addgene_118857 Copy
Vector Backbone Description: Vector Backbone:MiniCoopR; Vector Types:CRISPR, Tol2; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30385465
Comments: Use the BseRI enzyme to clone gRNA of interest in the U6:gRNA cassette. Use primer: CCATACCACATTTGTAGAGGT to sequence insert
Proper citation: RRID:Addgene_118840 Copy
Species: Homo sapiens
Genetic Insert: htt 103Q
Vector Backbone Description: Backbone Size:0; Vector Backbone:p426 GAL; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10677504
Comments: N terminal region of Ht with polyQ repeat length of 103 fused to GFP.
Proper citation: RRID:Addgene_1188 Copy
Species: Synthetic
Genetic Insert: Synthetic
Vector Backbone Description: Vector Backbone:pCS2-Dest; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31653829
Proper citation: RRID:Addgene_118803 Copy
Species: Homo sapiens
Genetic Insert: death-domain associated protein (Daxx)
Vector Backbone Description: Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23405218
Proper citation: RRID:Addgene_119021 Copy
Species: Rattus norvegicus
Genetic Insert: GABRA5
Vector Backbone Description: Vector Backbone:pEGFP N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_118956 Copy
Species: Mus musculus
Genetic Insert: OptoTGFBRs
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3925; Vector Backbone:ptdToamto-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29241005
Proper citation: RRID:Addgene_118942 Copy
Species: Homo sapiens
Genetic Insert: iRFP682-Smad2
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:piRFP682-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29241005
Proper citation: RRID:Addgene_118943 Copy
Genetic Insert: A0201-Mart1-SABR
Vector Backbone Description: Backbone Marker:Donald B. Kohn's laboratory at UCLA; Backbone Size:6600; Vector Backbone:pCCLc-MND; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30700902
Proper citation: RRID:Addgene_119052 Copy
Species: Synthetic
Genetic Insert: Voltron-ST
Vector Backbone Description: Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31371562
Comments: 5' cloning site: NheI, 3' cloning site: HindIII
Proper citation: RRID:Addgene_119034 Copy
Genetic Insert: VSVG
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:9288971
Comments: The EGFP (Clontech Laboratories, Inc., Palo, Alto, CA) contains a valine immediately after the start codon that is not found in the wild type sequence. However, to avoid confusion with previously published work on GFP mutants, the wild type residue numbers are used. The Kozak sequence at the beginning of the GFP encoding region of the pEGFP-N1 plasmid from Clontech has been disrupted. Reference for the A206K mutation is Zacharias, D. A., Violin, J. D., Newton, A. C., and Tsien, R. Y. (2002) Science 296, 913-6. Reference for PAGFP is Patterson, G. H., and Lippincott-Schwartz, J. (2002) Science 297, 1873-7.
Proper citation: RRID:Addgene_11915 Copy
Species: Aequorea victoria
Genetic Insert: pRSETA-PAGFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2827; Vector Backbone:pRSETA; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12228718
Comments: The fluorescent protein encoding region contains one of the three substitutions (A206K) suggested by Dr. Roger Tsien. This mutation disrupts fluorescent protein dimerization even at high concentrations. The mutation does not seem to have much effect on the fluorescent properties of the CFP, GFP and YFP versions, so hopefully it will not affect PAGFP too much. The PAGFP A206K mutant does not display obvious fluorescent differences compared with the original, but please bear in mind that I haven't characterized it to the same extent.
The citation for the A206K mutation in fluorescent proteins is Science 2002 296:913.
Proper citation: RRID:Addgene_11911 Copy
Species: Aequorea victoria
Genetic Insert: PAGFP
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12228718
Comments: The pPAGFP-C1 was not published. It was prepared by removing the PAGFP cDNA from pPAGFP-N1 with an AgeI/BsrGI restriction digest and subcloning it into a similarly digested pEYFP-C1 (Clontech). The pPAGFP-C1 was confirmed by sequencing. If you use this construct in future publications, use your best judgement for citation.
The fluorescent protein encoding region contains one of the three substitutions (A206K) suggested by Dr. Roger Tsien. This mutation disrupts fluorescent protein dimerization even at high concentrations. The mutation does not seem to have much effect on the fluorescent properties of the CFP, GFP and YFP versions, so hopefully it will not affect PAGFP too much. The PAGFP A206K mutant does not display obvious fluorescent differences compared with the original, but please bear in mind that I haven't characterized it to the same extent.
The citation for the A206K mutation in fluorescent proteins is Science 2002 296:913.
Proper citation: RRID:Addgene_11910 Copy
Species: Other
Genetic Insert: mCherry and eGFP
Vector Backbone Description: Backbone Size:9990; Vector Backbone:plenti-CMV-mCherry-T2A-GFP; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30679582
Proper citation: RRID:Addgene_119129 Copy
Species: Homo sapiens
Genetic Insert: PIS
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:mCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23263280
Proper citation: RRID:Addgene_119078 Copy
Species: Aequorea victoria
Genetic Insert: pPAGFP-N1
Vector Backbone Description: Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12228718
Comments: The fluorescent protein encoding region contains one of the three substitutions (A206K) suggested by Dr. Roger Tsien. This mutation disrupts fluorescent protein dimerization even at high concentrations. The mutation does not seem to have much effect on the fluorescent properties of the CFP, GFP and YFP versions, so hopefully it will not affect PAGFP too much. The PAGFP A206K mutant does not display obvious fluorescent differences compared with the original, but please bear in mind that I haven't characterized it to the same extent.
The citation for the A206K mutation in fluorescent proteins is Science 2002 296:913.
Proper citation: RRID:Addgene_11909 Copy
Species: Caenorhabditis elegans
Genetic Insert: lin-41 miRNA target sequence
Vector Backbone Description: Backbone Marker:Available at Addgene (plasmid 12178); Backbone Size:5264; Vector Backbone:pIS0; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14697198
Comments: Used to test effects of lin-41 microRNA (let-7).
Proper citation: RRID:Addgene_11906 Copy
Species: bacteriophage P1
Genetic Insert: cre
Vector Backbone Description: Backbone Size:6600; Vector Backbone:na; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10334853
Comments: pBS513 carries the wt cre gene under the control of the elongation factor-1 alpha (EF-1 alpha) promoter. The construct carries an upstream Kozak modification to increase expression. The resulting construct provides very strong expression in many different types of cells, including murine embryonic stem (ES) cells. For cell culture work this construct is recommended as a replacement for the CMV-cre construct pBS185 as it provides much stronger expression. However, pBS513 is not suitable for use in transgenic mice as such EF-1 alpha transgene constructs are often inactive in many tissues.
Please note: The following enzymes are NOT single cutters: PstI, AflIII, and SacI. We do not suggest using these enzymes for cloning.
Proper citation: RRID:Addgene_11918 Copy
Species: Other
Genetic Insert: dcas9
Vector Backbone Description: Vector Backbone:R6Kgamma; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30617347
Proper citation: RRID:Addgene_119271 Copy
Genetic Insert: STOP
Vector Backbone Description: Backbone Size:3806; Vector Backbone:n/a; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8231893
Comments: pBS302 carries two directly repeated loxP sites flanking a synthetic DNA sequence designated "STOP." The lox-square STOP cassette sits on a NotI fragment that can excised and gel-purified for injection into fertilized zygotes. The STOP sequence is designed to thwart productive expression of a downstream gene under the control of an upstream promoter (to be inserted in the SfiI-SpeI polylinker region). It will have been removed in cells expressing Cre, or in descendants of cells that previously had expressed Cre, because of Cre-mediated recombination at the loxP sites. The STOP sequence is the same as used to regulate T-Ag expression in pBS241.
Proper citation: RRID:Addgene_11925 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.