Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pQLinkHD_ECFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_118857 | ECFP | Other | Ampicillin | PMID:30339749 | Vector Backbone:pQLinkHD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:03:07 | 1 | ||
|
MiniCoopR U6:gRNA, mitfa:Cas9 Resource Report Resource Website 1+ mentions |
RRID:Addgene_118840 | Ampicillin | PMID:30385465 | Use the BseRI enzyme to clone gRNA of interest in the U6:gRNA cassette. Use primer: CCATACCACATTTGTAGAGGT to sequence insert | Vector Backbone:MiniCoopR; Vector Types:CRISPR, Tol2; Bacterial Resistance:Ampicillin | 2026-08-15 01:03:08 | 1 | |||
|
p426 103Q GAL Resource Report Resource Website 1+ mentions |
RRID:Addgene_1188 | htt 103Q | Homo sapiens | Ampicillin | PMID:10677504 | N terminal region of Ht with polyQ repeat length of 103 fused to GFP. | Backbone Size:0; Vector Backbone:p426 GAL; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:03:07 | 1 | |
|
pHBS1389 IBB-GFP-mCherry3E Resource Report Resource Website 1+ mentions |
RRID:Addgene_118803 | Synthetic | Synthetic | Ampicillin | PMID:31653829 | Vector Backbone:pCS2-Dest; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:03:07 | 3 | ||
|
Daxx/pEGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_119021 | death-domain associated protein (Daxx) | Homo sapiens | Kanamycin | PMID:23405218 | Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:03:09 | 3 | ||
|
alpha5-EGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_118956 | GABRA5 | Rattus norvegicus | Kanamycin | Vector Backbone:pEGFP N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:03:08 | 2 | |||
|
pCMV-OptoTGFBRs Resource Report Resource Website 1+ mentions |
RRID:Addgene_118942 | OptoTGFBRs | Mus musculus | Kanamycin | PMID:29241005 | Backbone Marker:Clontech; Backbone Size:3925; Vector Backbone:ptdToamto-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:03:08 | 1 | ||
|
iRFP682-Smad2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_118943 | iRFP682-Smad2 | Homo sapiens | Kanamycin | PMID:29241005 | Backbone Marker:Clontech; Vector Backbone:piRFP682-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:03:08 | 2 | ||
|
pCCLc-MND-A0201-Mart1-SABR Resource Report Resource Website 1+ mentions |
RRID:Addgene_119052 | A0201-Mart1-SABR | Ampicillin | PMID:30700902 | Backbone Marker:Donald B. Kohn's laboratory at UCLA; Backbone Size:6600; Vector Backbone:pCCLc-MND; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:03:09 | 1 | |||
|
pCAG-Voltron-ST Resource Report Resource Website 1+ mentions |
RRID:Addgene_119034 | Voltron-ST | Synthetic | Ampicillin | PMID:31371562 | 5' cloning site: NheI, 3' cloning site: HindIII | Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:03:09 | 1 | |
|
pPAGFP-VSVG Resource Report Resource Website 1+ mentions |
RRID:Addgene_11915 | VSVG | Kanamycin | PMID:9288971 | The EGFP (Clontech Laboratories, Inc., Palo, Alto, CA) contains a valine immediately after the start codon that is not found in the wild type sequence. However, to avoid confusion with previously published work on GFP mutants, the wild type residue numbers are used. The Kozak sequence at the beginning of the GFP encoding region of the pEGFP-N1 plasmid from Clontech has been disrupted. Reference for the A206K mutation is Zacharias, D. A., Violin, J. D., Newton, A. C., and Tsien, R. Y. (2002) Science 296, 913-6. Reference for PAGFP is Patterson, G. H., and Lippincott-Schwartz, J. (2002) Science 297, 1873-7. | Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | (L64F/T65S/V163A/T203H). The PAGFP also contains an A206K mutation to disrupt dimerization. The EGFP (Clontech Laboratories, Inc., Palo, Alto, CA) contains a valine immediately after the start codon that is not found in the wild type sequence. However, to avoid confusion with previously published work on GFP mutants, the wild type residue numbers are used. | 2026-08-15 01:03:11 | 2 | |
|
pRSETA-PAGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_11911 | pRSETA-PAGFP | Aequorea victoria | Ampicillin | PMID:12228718 | The fluorescent protein encoding region contains one of the three substitutions (A206K) suggested by Dr. Roger Tsien. This mutation disrupts fluorescent protein dimerization even at high concentrations. The mutation does not seem to have much effect on the fluorescent properties of the CFP, GFP and YFP versions, so hopefully it will not affect PAGFP too much. The PAGFP A206K mutant does not display obvious fluorescent differences compared with the original, but please bear in mind that I haven't characterized it to the same extent. The citation for the A206K mutation in fluorescent proteins is Science 2002 296:913. | Backbone Marker:Invitrogen; Backbone Size:2827; Vector Backbone:pRSETA; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | The PAGFP has four mutations (L64F/T65S/V163A/T203H) compared with the Clontech EGFP. The PAGFP also contains an A206K mutation to disrupt dimerization | 2026-08-15 01:03:10 | 4 |
|
pPAGFP-C1 Resource Report Resource Website 10+ mentions |
RRID:Addgene_11910 | PAGFP | Aequorea victoria | Kanamycin | PMID:12228718 | The pPAGFP-C1 was not published. It was prepared by removing the PAGFP cDNA from pPAGFP-N1 with an AgeI/BsrGI restriction digest and subcloning it into a similarly digested pEYFP-C1 (Clontech). The pPAGFP-C1 was confirmed by sequencing. If you use this construct in future publications, use your best judgement for citation. The fluorescent protein encoding region contains one of the three substitutions (A206K) suggested by Dr. Roger Tsien. This mutation disrupts fluorescent protein dimerization even at high concentrations. The mutation does not seem to have much effect on the fluorescent properties of the CFP, GFP and YFP versions, so hopefully it will not affect PAGFP too much. The PAGFP A206K mutant does not display obvious fluorescent differences compared with the original, but please bear in mind that I haven't characterized it to the same extent. The citation for the A206K mutation in fluorescent proteins is Science 2002 296:913. | Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | These plasmids are essentially the same as the Clontech pEGFP-C1 version with four mutations (L64F/T65S/V163A/T203H). The PAGFP also contains an A206K mutation to disrupt dimerization | 2026-08-15 01:03:10 | 10 |
|
eGFP L202 Reporter Resource Report Resource Website 1+ mentions |
RRID:Addgene_119129 | mCherry and eGFP | Other | Ampicillin | PMID:30679582 | Backbone Size:9990; Vector Backbone:plenti-CMV-mCherry-T2A-GFP; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | eGFP L202S | 2026-08-15 01:03:10 | 1 | |
|
mCherry-PIS Resource Report Resource Website 1+ mentions |
RRID:Addgene_119078 | PIS | Homo sapiens | Kanamycin | PMID:23263280 | Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:mCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:03:10 | 1 | ||
|
pPAGFP-N1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_11909 | pPAGFP-N1 | Aequorea victoria | Kanamycin | PMID:12228718 | The fluorescent protein encoding region contains one of the three substitutions (A206K) suggested by Dr. Roger Tsien. This mutation disrupts fluorescent protein dimerization even at high concentrations. The mutation does not seem to have much effect on the fluorescent properties of the CFP, GFP and YFP versions, so hopefully it will not affect PAGFP too much. The PAGFP A206K mutant does not display obvious fluorescent differences compared with the original, but please bear in mind that I haven't characterized it to the same extent. The citation for the A206K mutation in fluorescent proteins is Science 2002 296:913. | Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | These plasmids are essentially the same as the Clontech pEGFP-N1 version with four mutations (L64F/T65S/V163A/T203H). The PAGFP also contains an A206K mutation to disrupt dimerization | 2026-08-15 01:03:10 | 8 |
|
pISlin41w(s) (lin-41 microRNA wt reporter) Resource Report Resource Website 1+ mentions |
RRID:Addgene_11906 | lin-41 miRNA target sequence | Caenorhabditis elegans | Ampicillin | PMID:14697198 | Used to test effects of lin-41 microRNA (let-7). | Backbone Marker:Available at Addgene (plasmid 12178); Backbone Size:5264; Vector Backbone:pIS0; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:03:09 | 1 | |
|
pBS513 EF1alpha-cre Resource Report Resource Website 1+ mentions |
RRID:Addgene_11918 | cre | bacteriophage P1 | Ampicillin | PMID:10334853 | pBS513 carries the wt cre gene under the control of the elongation factor-1 alpha (EF-1 alpha) promoter. The construct carries an upstream Kozak modification to increase expression. The resulting construct provides very strong expression in many different types of cells, including murine embryonic stem (ES) cells. For cell culture work this construct is recommended as a replacement for the CMV-cre construct pBS185 as it provides much stronger expression. However, pBS513 is not suitable for use in transgenic mice as such EF-1 alpha transgene constructs are often inactive in many tissues. Please note: The following enzymes are NOT single cutters: PstI, AflIII, and SacI. We do not suggest using these enzymes for cloning. | Backbone Size:6600; Vector Backbone:na; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-15 01:03:12 | 5 | |
|
pJMP1339 Resource Report Resource Website 1+ mentions |
RRID:Addgene_119271 | dcas9 | Other | Ampicillin | PMID:30617347 | Vector Backbone:R6Kgamma; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | D10A and H840A | 2026-08-15 01:03:12 | 3 | |
|
pBS302 Resource Report Resource Website 1+ mentions |
RRID:Addgene_11925 | STOP | Ampicillin | PMID:8231893 | pBS302 carries two directly repeated loxP sites flanking a synthetic DNA sequence designated "STOP." The lox-square STOP cassette sits on a NotI fragment that can excised and gel-purified for injection into fertilized zygotes. The STOP sequence is designed to thwart productive expression of a downstream gene under the control of an upstream promoter (to be inserted in the SfiI-SpeI polylinker region). It will have been removed in cells expressing Cre, or in descendants of cells that previously had expressed Cre, because of Cre-mediated recombination at the loxP sites. The STOP sequence is the same as used to regulate T-Ag expression in pBS241. | Backbone Size:3806; Vector Backbone:n/a; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-15 01:03:11 | 9 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
