Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:homo sapiens (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

69,553 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pCMV-CD63-FKBP-Myc
 
Resource Report
Resource Website 		RRID:Addgene_177910 human CD63 Homo sapiens Ampicillin PMID:35594496 Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:12 0
pM-ErbB4-delta-kinase
 
Resource Report
Resource Website 		RRID:Addgene_17800 ErbB4 Homo sapiens Ampicillin PMID:12807903 Backbone Marker:BD Biosciences; Backbone Size:3500; Vector Backbone:pM; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Carboxy-terminal fragment, amino acids 988-1292, kinase domain deleted 2026-08-15 01:11:14 0
pM-ErbB4-delta-kinase-PY3 mutant
 
Resource Report
Resource Website 		RRID:Addgene_17802 ErbB4 Homo sapiens Ampicillin PMID:12807903 Backbone Marker:BD Biosciences; Backbone Size:3500; Vector Backbone:pM; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Carboxy-terminal fragment, amino acids 988-1292, kinase domain deleted, Tyrosine 1301 changed to Alanine 2026-08-15 01:11:13 0
UBQLN2_Halo_C_allele
 
Resource Report
Resource Website 		RRID:Addgene_178119 Halotag Homo sapiens Ampicillin Vector Backbone:pUC57-BsaI-Free; Vector Types:Donor vector; Bacterial Resistance:Ampicillin 2026-08-15 01:11:14 0
PRNP_Halo_C_allele
 
Resource Report
Resource Website 		RRID:Addgene_178116 Halotag Homo sapiens Ampicillin Vector Backbone:pUC57-BsaI-Free; Vector Types:Donor vector; Bacterial Resistance:Ampicillin 2026-08-15 01:11:14 0
PFN1_Halo_C_allele
 
Resource Report
Resource Website 		RRID:Addgene_178117 Halotag Homo sapiens Ampicillin Vector Backbone:pUC57-BsaI-Free; Vector Types:Donor vector; Bacterial Resistance:Ampicillin 2026-08-15 01:11:14 0
pACEBac1-ZZ-TEV-MZT2-3C-mEGFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_178074 MZT2A Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-08-15 01:11:14 3
pACEBac1-GCP5
 
Resource Report
Resource Website 		RRID:Addgene_178071 GCP5 Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-08-15 01:11:14 0
pACEBac1-GCP6
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_178072 GCP6 Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-08-15 01:11:13 1
pACEBac1-gamma-tubulin(N229A)-TEV-His6
 
Resource Report
Resource Website 		RRID:Addgene_178077 gamma-tubulin with an N229A point mutation Homo sapiens Gentamicin PMID:33496729 Primers used to generate pACEBac1-gamma-tubulin(N229A)-TEV-His6 via site-directed mutagenesis were CCCATCCTTCTCCCAGATCGCCCAGCTGGTGTCTACCATCATGTC and GACATGATGGTAGACACCAGCTGGGCGATCTGGGAGAAGGATGGG Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin Changed Asparagine 229 to Alanine 2026-08-15 01:11:14 0
pACEBac1-MZT1
 
Resource Report
Resource Website 		RRID:Addgene_178075 MZT1 Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-08-15 01:11:13 0
pACEBac1-beta-actin
 
Resource Report
Resource Website 		RRID:Addgene_178076 beta-actin Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-08-15 01:11:13 0
ATP1A1_G6_T804N_MTOR_F2108L_Dual_pegRNA
 
Resource Report
Resource Website 		RRID:Addgene_178109 ATP1A1 G6 T804N pegRNA + MTOR-F2108L pegRNA Homo sapiens Ampicillin PMID:36207338 Control pegRNA vector derived from ATP1A1_G6_T804N_Dual_pegRNA. This vector can be used as a positive control for prime editing (PE3 in combination with ATP1A1_G8_MTOR_Nick_Intron-45_Dual_sgRNA) to co-target ATP1A1 (T804N) and MTOR to perform coselection for MTOR rapamycin resistance mutation F2108L. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint. Vector Backbone:pU6-pegRNA-GG-acceptor; Vector Types:Mammalian Expression, CRISPR, Prime editing; Bacterial Resistance:Ampicillin 2026-08-15 01:11:14 0
ATP1A1_G8_MTOR_Nick_Exon-53_Dual_sgRNA
 
Resource Report
Resource Website 		RRID:Addgene_178107 ATP1A1 G8 + MTOR nick exon-53 sgRNAs Homo sapiens Ampicillin PMID:36207338 Control PE3 nick sgRNAs vector derived from ATP1A1_G8_Dual_sgRNA. This vector can be used as a positive control for prime editing (PE3) to co-target ATP1A1 (T804N) and MTOR to perform coselection for MTOR hyperactivating mutation E2419K. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint. Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR, Prime editing; Bacterial Resistance:Ampicillin 2026-08-15 01:11:15 0
ATP1A1_G8_MTOR_Nick_Intron-45_Dual_sgRNA
 
Resource Report
Resource Website 		RRID:Addgene_178106 ATP1A1 G8 + MTOR nick intron-45 sgRNAs Homo sapiens Ampicillin PMID:36207338 Control PE3 nick sgRNAs vector derived from ATP1A1_G8_Dual_sgRNA. This vector can be used as a positive control for prime editing (PE3) to co-target ATP1A1 (T804N) and MTOR to perform coselection for MTOR rapamycin resistance mutation F2108L. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint. Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR, Prime editing; Bacterial Resistance:Ampicillin 2026-08-15 01:11:14 0
pACEBac1-gamma-tubulin-TEV-His6
 
Resource Report
Resource Website 		RRID:Addgene_178067 gamma-tubulin Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-08-15 01:11:13 0
pcDNA3-I531T-WLS-HA-IRES-GFP
 
Resource Report
Resource Website 		RRID:Addgene_178064 WLS Homo sapiens Ampicillin PMID:34587386 Backbone Marker:Addgene (#51406); Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin I531T 2026-08-15 01:11:13 0
ANXA11_Halo_C_allele
 
Resource Report
Resource Website 		RRID:Addgene_178136 Halotag Homo sapiens Ampicillin Vector Backbone:pUC57-BsaI-Free; Vector Types:Donor vector; Bacterial Resistance:Ampicillin 2026-08-15 01:11:14 0
POLG_Halo_C_allele
 
Resource Report
Resource Website 		RRID:Addgene_178134 Halotag Homo sapiens Ampicillin Vector Backbone:pUC57-BsaI-Free; Vector Types:Donor vector; Bacterial Resistance:Ampicillin 2026-08-15 01:11:15 0
MATR3_Halo_C_allele
 
Resource Report
Resource Website 		RRID:Addgene_178135 Halotag Homo sapiens Ampicillin Vector Backbone:pUC57-BsaI-Free; Vector Types:Donor vector; Bacterial Resistance:Ampicillin 2026-08-15 01:11:14 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch