Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:ampicillin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

328,630 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
p2Bac.Flag.p34
 
Resource Report
Resource Website 		RRID:Addgene_39221 p34 Homo sapiens Ampicillin Backbone Marker:Invitrogen; Backbone Size:7125; Vector Backbone:p2Bac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:26 0
p2Bac.Myc.p44
 
Resource Report
Resource Website 		RRID:Addgene_39220 p44 Ampicillin Backbone Marker:Invitrogen; Backbone Size:7125; Vector Backbone:p2Bac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:26 0
pCMV-myc-ERK2-MEK1_fusion
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_39194 ERK2-MEK1 Fusion Homo sapiens Ampicillin PMID:9799732 rat ERK2 fused to human MEK1 with a linker in between Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:26 7
pFB-CT10HF-LIC
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_39191 none Ampicillin Primers for LIC cloning: Add the following 5’ extensions to the PCR primers: Upstream: TTAAGAAGGAGATATACTATG (ATG-initiation codon) Downstream: GATTGGAAGTAGAGGTTCTCTGC The purified PCR fragments are treated with T4 DNA polymerase and dGTP, then annealed to the treated vector. Backbone Marker:SGC; Vector Backbone:pFB-CT10HF-LIC; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin 2026-08-15 01:14:26 8
p2Bac.HA.p52
 
Resource Report
Resource Website 		RRID:Addgene_39219 p52 Homo sapiens Ampicillin Backbone Marker:Invitrogen; Backbone Size:7125; Vector Backbone:p2Bac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:26 0
pMAL-XPG
 
Resource Report
Resource Website 		RRID:Addgene_39215 XPG Homo sapiens Ampicillin PMID:7657672 Backbone Marker:New England Biolabs; Backbone Size:6646; Vector Backbone:pMAL-c2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Note that XPG starts at amino acid 5 2026-08-15 01:14:26 0
ABL2
 
Resource Report
Resource Website 		RRID:Addgene_39178 ABL2 Homo sapiens Ampicillin http://www.thesgc.org/structures/3GVU/ Backbone Marker:SGC; Vector Backbone:pFB-LIC-Bse; Vector Types:Baculovirus Expression; Bacterial Resistance:Ampicillin Truncated (see comments) 2026-08-15 01:14:26 0
BBOX1
 
Resource Report
Resource Website 		RRID:Addgene_39176 BBOX1 Homo sapiens Ampicillin http://www.thesgc.org/structures/3MS5/ Backbone Marker:SGC; Vector Backbone:pFB-LIC-Bse; Vector Types:Baculovirus Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:26 0
ROR2
 
Resource Report
Resource Website 		RRID:Addgene_39183 ROR2 Homo sapiens Ampicillin http://www.thesgc.org/structures/3ZZW/ Backbone Marker:SGC; Vector Backbone:pFBOH-MHL; Vector Types:Baculovirus Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:26 0
ACSM2B
 
Resource Report
Resource Website 		RRID:Addgene_39167 ACSM2B Homo sapiens Ampicillin http://www.thesgc.org/structures/3C5E/ Backbone Marker:SGC; Vector Backbone:pFB-LIC-Bse; Vector Types:Baculovirus Expression; Bacterial Resistance:Ampicillin Actually the mitochondrial form, GI:58082049, with L64P mutation 2026-08-15 01:14:26 0
NEK2
 
Resource Report
Resource Website 		RRID:Addgene_39163 NEK2 Homo sapiens Ampicillin http://www.thesgc.org/structures/2JAV/ Backbone Marker:SGC; Vector Backbone:pET22b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin T175A inactivating mutant 2026-08-15 01:14:26 0
PTPN5
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_39166 PTPN5 Homo sapiens Ampicillin http://www.thesgc.org/structures/2BIJ/ Backbone Marker:SGC; Vector Backbone:pLIC-SGC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:26 3
PTPRB
 
Resource Report
Resource Website 		RRID:Addgene_39165 PTPRB Homo sapiens Ampicillin http://www.thesgc.org/structures/2AHS/ Backbone Marker:SGC; Vector Backbone:pGEX-6P-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:25 0
TNIK
 
Resource Report
Resource Website 		RRID:Addgene_39171 TNIK Homo sapiens Ampicillin http://www.thesgc.org/structures/2X7F/ Backbone Marker:SGC; Vector Backbone:pFB-LIC-Bse; Vector Types:Baculovirus Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:26 0
MST4
 
Resource Report
Resource Website 		RRID:Addgene_39172 MST4 Homo sapiens Ampicillin http://www.thesgc.org/structures/3GGF/ Backbone Marker:SGC; Vector Backbone:pLIC-SGC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:26 0
HSD17B4
 
Resource Report
Resource Website 		RRID:Addgene_39156 HSD17B4 Homo sapiens Ampicillin http://www.thesgc.org/structures/1ZBQ/ Backbone Marker:SGC; Vector Backbone:pLIC-SGC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin codon-optimized 2026-08-15 01:14:25 0
PECR
 
Resource Report
Resource Website 		RRID:Addgene_39158 PECR Homo sapiens Ampicillin http://www.thesgc.org/structures/1YXM/ Backbone Marker:SGC; Vector Backbone:pLIC-SGC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin codon-optimized 2026-08-15 01:14:25 0
HSD17B10
 
Resource Report
Resource Website 		RRID:Addgene_39153 HSD17B10 Homo sapiens Ampicillin http://www.thesgc.org/structures/2O23/ Backbone Marker:SGC; Vector Backbone:pLIC-SGC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin codon-optimized 2026-08-15 01:14:25 0
HSD11B1
 
Resource Report
Resource Website 		RRID:Addgene_39155 HSD11B1 Homo sapiens Ampicillin http://www.thesgc.org/structures/2BEL/ Alt_Gene_1=HSD11B1: hydroxysteroid (11-beta) dehydrogenase 1 [RefSeq isoform 1; tv1] (aka HDL, 11-DH, HSD11, HSD11B, HSD11L, MGC13539, 11-beta-HSD1) Backbone Marker:SGC; Vector Backbone:pLIC-SGC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin T220I; codon-optimized 2026-08-15 01:14:25 0
HPGD
 
Resource Report
Resource Website 		RRID:Addgene_39154 HPGD Homo sapiens Ampicillin http://www.thesgc.org/structures/2GDZ/ Backbone Marker:SGC; Vector Backbone:pLIC-SGC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin codon-optimized 2026-08-15 01:14:25 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch